
Druckversion | Impressum | Datenschutz | Aktuelle Version

Corona in Dithmarschen: Unterschied zwischen den Versionen

Aus Dithmarschen-Wiki

(mögliche Quellen für die Insertion)
(mögliche Quellen für die Insertion)
Zeile 989: Zeile 989:
* KP099941.1 (1.170..1.181) Echovirus E25 strain XM0297 (China: Fujian / 2013)
* KP099941.1 (1.170..1.181) Echovirus E25 strain XM0297 (China: Fujian / 2013)
* AK120063.1 (1.300..1.311) Oryza sativa Japonica Group cDNA clone:J013001K22, full insert sequence
* AK120063.1 (1.300..1.311) Oryza sativa Japonica Group cDNA clone:J013001K22, full insert sequence
* ACU98579.1 ([https://kiemlicz.med.virginia.edu/mcsg/space_tree/view/APC111006 1.855..1.866)] membrane carboxypeptidase (penicillin-binding protein) [Saccharomonospora viridis DSM 43017]

Version vom 23. Januar 2022, 02:17 Uhr

Ausbreitung der Fledermäuse

Lizenz: CC BY 4.0

DOI: 10.21203/rs.3.rs-885194/v1 Figure 1 (unverändert)

Autors: Zhiqiang Wu, Yelin Han, Yuyang Wang, Bo Liu, Lamei Zhao, Junpeng Zhang, Hao-Xiang Su, Wenliang Zhao, Liguo Liu, Shibin Bai, Jie Dong, Lilian Sun, Yafang Zhu, Siyu Zhou, Yiping Song, Hongtao Sui, Jian Yang, Jianwei Wang, Shuyi Zhang, Zhaohui Qian, Qi Jin

Corona ist nicht nur eine heilige Schutzpatronin die uns vor Seuchen schützt, sondern auch eine hochansteckende Krankheit die manchmal tödlich endet.

Es gibt auch andere Sichtweisen:

[1] Corona Ausschuss [2] Kritischer Journalismus. Ohne "Haltung". Ohne Belehrung. Ohne Ideologie.

In einer Pandemie ist es hilfreich zwischen Fakten und Meinungen zu unterscheiden. Wenn ich mich krank fühle gehe ich zum Arzt und frage nicht einen Journalisten oder eine Anwältin ob meine Krankheit wirklich gefährlich ist.

Bitte beachten Sie die Allgemeinverfügungen vom Kreis Dithmarschen.

Aktueller Stand:

  • Es ist immer noch nicht gelungen die Herkunft aus einem Labor zu beweisen.
  • Die nächsten Verwandten von Corona kommen aus Laos. DOI:10.21203/rs.3.rs-871965/v1
  • Die Schnittstelle der 3C-ähnlichen Proteinase (nsp5) sieht so aus: [ILMVF]-Q-|-[SGACN]. Quelle UniProtKB - P0C6U8 Die eckigen Klammern bedeuten eine der aufgezählten Aminosäuren muss vorhanden sein. Der Strich markiert die Schnittstelle. Es werden also 3 Aminosäuren benötigt um eine Schnittstelle zu identifizieren.



Die 7-Tages-Inzidenz für den Kreis Dithmarschen beträgt: 615,38/100.000 pro Woche (Stand: 14.01.2022)

Im Vergleich zur Vorwoche ist die Inzidenz um 22,7% gefallen.

Neuer Tagesrekord am 06.01.2022: 349

Neuer Inzidenz-Rekord am 12.01.2022: 831,51

Die Neuinfektionen der letzten 7 Tage betragen 55+175+56+148+167+118+101=820. Die 820 Neuinfektionen werden durch die Einwohnerzahl geteilt. Anschließend wird das Ganze noch mit 100.000 multipliziert. (Einige Summanden sind derzeit fehlerhaft.)

Basierend auf der Einwohnerzahl vom 31.12.2020: 133.251

Hinweis zu Zahlen die sich auf Krankenhäuser beziehen

Der Kreis Dithmarschen und Boyens Medien verraten uns täglich wie viele Dithmarscher sich im Krankenhaus befinden. Die gesamte Anzahl an Covid-Patienten ist meistens größer, da auch Patienten aus anderen Kreisen und Bundesländern in Dithmarschen behandelt werden.

Die Zahlen vom Divi-Intensivbetten-Register beziehen sich auf Krankenhäuser. Das heißt wir wissen nicht wie viele davon Dithmarscher sind.


Ist ein Testergebnis positiv so wird dieses an das Kreisgesundheitsamt weiter geleitet. Der Kreis Dithmarschen bekommt die Zahlen vom Kreisgesundheitsamt und veröffentlicht diese auf seiner Homepage unter Neues erfahren/Coronavirus sowie auf seiner Facebook-Seite. Anschließend findet man die Zahlen dann auch noch bei Boyens Medien.


Monat infiziert genesen verst.
März 28 5 0
April 27 44 3
Mai 5 6 0
Juni 15 5 1
Juli 46 13 0
August 32 66 1
Sept. 61 29 0
Oktober 191 103 5
Nov. 206 245 4
Dez. 349 245 12
2020 960 761 26
Monat infiziert genesen verst.
Januar 285 348 12
Februar 72 138 3
März 199 115 1
April 323 279 1
Mai 126 239 6
Juni 15 46 4
Juli 44 7 0
August 318 165 0
Sept. 235 371 1
Oktober 188 138 1
Nov. 508 408 4
Dez. 1.181 594 2
2021 3.494 2.848 35
Monat infiziert genesen verst.

Dezember 2021

Tag 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31
Neuinfektionen 16 10 26 19 11 16 35 28 12 31 23 11 1 34 16 18 16 22 4 14 34 15 42 43 47 62 41 91 105 165 174
Genesene 28 32 13 9 19 2 15 32 8 20 5 18 40 20 13 32 19 38 11 20 23 1 21 16 25 18 12 3 23 35 23
Verstorbene 1 1
aktive Fälle 178 156 169 179 171 184 203 199 203 214 232 225 186 200 203 189 186 170 163 157 168 182 203 230 254 298 327 415 497 627 778
7 Tage 120 113 118 118 121 128 132 145 147 152 156 156 141 140 128 134 119 118 111 124 124 123 147 174 199 257 284 341 431 554 685
  • Am 26.12.2021 gibt es eine kleine Differenz zwischen RKI und Kreis.
  • Am 31.12.2021 liegt die Inzidenz über 500 was beim RKI der Farbe lila entspricht. Ich welchsel die Farben weniger oft, und zwar bei 35, 50, 250 und 1.000.

Januar 2022

Tag 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31
Neuinfektionen 151 84 84 122 113 349 158 55 175 56 148 167 118 101
Genesene 0 28 13 24 39 36 22 0 0 13
Verstorbene 1 1 1
aktive Fälle 921 976 1.046 1.146 1.218 1.532 1.674 1.730 1.898 1.940
7 Tage 787 808 851 884 893 1.077 1.061 965 1.056 1.028 1.054 1.108 877 820

Ältere Tabellen befinden sich auf der Diskussionsseite.

Die Situation im Landkreis Dithmarschen

  • 05.03.2020: Das neuartige Coronavirus auch COVID-19 oder SARS-CoV-2 oft auch nur Corona genannt erreicht den Kreis Dithmarschen. Wir haben jetzt eine Infizierte.
  • 15.03.2020: Es gibt 5 neue Fälle in Dithmarschen. Alle Personen sind Urlaubsrückkehrer aus dem Skigebiet Ischgl.
  • 16.03.2020: Es startet der Lockdown, die Folgen sind dass Schulen und Kitas bis zum Ende der Sommerferien geschlossen werden. Es gibt Notfallbetreuungen für Kinder von Eltern mit systemrelevanten Berufen. Bis zum 30. April sind alle öffentlichen Veranstaltungen untersagt. Es wird so ziemlich alles geschlossen was nicht dringend benötigt wird. Der Heider Wochenmarkt darf weiterhin stattfinden. In Restaurants gibt es Abstandsregeln für Tische. In Läden gibt es vereinzelt leere Regale bei Hygieneprodukten und haltbaren Lebensmitteln. Manche Geschäfte verlängern ihre Öffnungszeiten. Der Kreis Dithmarschen richtet ein Bürgertelefon ein. Restaurants müssen die Kontaktdaten ihrer Besucher registrieren. Es fahren weniger Züge und es gibt keine Fahrkartenkontrollen mehr. Die Stiftung Mensch schließt bis zum Ende der Osterferien. Das Amt Mitteldithmarschen sagt alle Sitzungen ab. Schleswig-Holsteinische Inseln werden ab 6 Uhr morgens für Touristen gesperrt. Wer in einem Risikogebiet oder einem besonders betroffenen Gebiet war darf 14 Tage keine öffentlichen Einrichtungen besuchen.Blutspenden finden weiterhin statt.
  • 18.03.2020: Alle Touristen müssen Beherbergungsbetriebe verlassen. Hotels werden geschlossen. Touristen dürfen Schleswig-Holstein nicht mehr betreten. Es haben sich 4 Urlaubsrückkehrer mit Corona infiziert.
  • 19.03.2020: Bus-ÖPNV wechselt zum Ferienfahrplan.
  • 20.03.2020: Private Veranstaltungen und Ansammlungen von mehr als 5 Personen werden untersagt, sofern keine Verwandtschaftsverhältnisse ersten Grades bestehen.
  • 21.03.2020: Wer aus einem Risikogebiet kommt muss 14 Tage in häusliche Quarantäne.
  • 22.03.2020: Ein weiterer Reiserückkehrer hat sich mit Corona infiziert.
  • 28.03.2020: Alle Reiserückkehrer müssen 14 Tage in häusliche Quarantäne.
  • 01.04.2020: In Burg hat ein Hausarzt als Vorsichtsmaßnahme seine Praxis geschlossen nachdem ein Patient positiv auf Corona getestet wurde. Dies war keine Auflage sondern eine freiwillige Maßnahme.
  • 01.04.2020: Der Kreis Dithmarschen kritisiert auf seiner Facebook-Seite hiesige „Hilfssheriffs“, die Jagd auf Autofahrer mit fremden Kennzeichen machen: „Menschen, die bei uns im Kreisgebiet leben und arbeiten,werden mit dem Auto angehalten, beleidigt und aufgefordert, in ihre Heimat zurückzukehren. Und das nur, weil ihr Auto ein auswärtiges Kennzeichen trägt.“
  • 08.04.2020: Der Bauhof in Heide hat heute die Sitzgelegenheiten an der St. Jürgen-Kirche mit Gittern abgesperrt.
  • 12. und 13.04.2020: Ostern
  • 16.04.2020: Lockerungen für Läden und Geschäfte bis zu 800 Quadratmeter.
  • 20.04.2020: Busse fahren wieder im Regelbetrieb. Erste Recyclinghöfe öffnen wieder.
  • 29.04.2020: Ab heute gilt Maskenpflicht. Mund-Nasen-Abdeckung beim Einkaufen und in öffentlichen Verkehrsmitteln ist jetzt Pflicht.
  • 30.04.2020: In Dithmarschen sind aktuell 4412 Frauen und Männer arbeitslos gemeldet. Im Vergleich zum Vorjahr ein Anstieg um 629 Personen oder 16,6%. Im Vergleich zum März ein Anstieg um 400 Personen oder 10%. Die Arbeitslosenquote beträgt 6,3%. Vor 1 Jahr waren es 5,5%.
  • 30.04.2020: Es werden weitere Recyclinghöfe geöffnet.
  • 07.05.2020: Die Stadt Heide verschärft die Corona-Vorsichtsmaßnahmen und -Kontrollen auf dem Wochenmarkt. Jetzt gilt auch auf dem Wochenmarkt eine Maskenpflicht.
  • 09.05.2020: Alle Geschäfte dürfen wieder öffnen unabhängig von Größe.
  • 09.05.2020: In Heide findet eine Mahnwache statt. Dutzende versammeln sich vor der St. Jürgen-Kirche. Es geht unter anderem um Zwangsimpfungen und Bill Gates.
  • 16.05.2020: Gaststätten schließen um 22 Uhr. Kosmetik im Gesicht wieder erlaubt. Sport im Innenbereich unter Auflagen wieder möglich. Schwimmbader bleiben geschlossen. Kinos dürfen maximal 50 Besucher pro Saal rein lassen. Werkstätten für Menschen mit Behinderungen dürfen wieder mit 25% ihrer Kapazität öffnen.
  • 29.05.2020: Das Bürgertelefon wird eingestellt. Es gab 3900 Anrufer.
  • 02.06.2020: Alle Recyclinghöfe haben wieder auf.
  • Am 4. und 5. Juni 2020 gab es in Dithmarschen keine bekannten aktiven Fälle.
  • 08.06.2020: Alle die ab dem 5. Juni aus Schweden eingereist sind müssen in Quarantäne.
  • 18.06.2020: In Burg haben sich in einer Alten- und Pflegeeinrichtung eine Angestellte und 6 Bewohner mit Corona infiziert. Am 9. Juli sind alle wieder coronafrei.
  • 01.07.2020: Eine Mitarbeiterin eines Kindergartens ist infiziert.
  • 27.07.2020: Seit Mitte der vergangenen Woche viele neue Fälle, überwiegend im Kontext Reiserückkehr.
  • 29.07.2020: Bürgertelefon wieder aktiv. Büsum führt ab Wochenende eine Maskenpflicht in der Fußgängerzone ein.
  • 31.07.2020: Verschärfte Corona-Regeln für Heide bis 07.08.2020. Mobile Testmobile werden aufgestellt.
  • 08.08.2020: Büsum verlängert die Maskenpflicht bis zum 23. August und vergrößert die räumliche Ausdehnung.
  • Seit 12.08.2020 gibt es immer mal wieder Verdachtsfälle an Schulen und Kindertagesstätten. Unter anderem in Meldorf, Heide, Marne, Tellingstedt, Buchholz, Büsum und Wesselburen
  • Ab 24.08.2020 gilt Maskenpflicht in Schulen.
  • 03.09.2020: Das Bürgertelefon wird wieder eingestellt.
  • Seit 21.09.2020 gibt es überwiegend Fälle in Wesselburen.
  • 28.09.2020: Alle Schulen in Wesselburen werden geschlossen.
  • 29.09.2020: Mehr als 1.000.000 Menschen sind weltweit im Zusammenhang mit dem neuartigen Coronavirus Sars-CoV2 verstorben.
  • 01.10.2020: Von 9 bis 12 Uhr sowie von 14 bis 19 Uhr können sich alle Rumänen in Wesselburen auf Corona testen lassen. Es wurden vorher schon 28 Rumänen positiv getestet. Bereits am frühen Morgen erschienen 50 Freiwillige. Ebenfalls wurde an der Grundschule in Wesselburen getestet. Insgesamt haben sich 309 Menschen testen lassen darunter 215 rumänische Mitbürger/innen.
  • 02.10.2020: Der US-Präsident Donald Trump hat sich mit Corona infiziert.
  • 08.10.2020: Alle Tests in Wesselburen wurden ausgewertet. Es wurden 23 positve Ergebnisse festgestellt. Als Maßnahme bleiben in der Stadt folgende Einrichtungen geschlossen: die Stadtbücherei, das Haus der Jugend, das Hebbel-Museum, die Spielplätze sowie der Sportplatz. Aktuell befinden sich alle mit Corona infizierten Dithmarscher in häuslicher Quarantäne.
  • 09.10.2020: Im Kreis Dithmarschen gibt es aktuell 13 freie Intensivbetten.
  • 15.10.2020: Das RKI meldet einen neuen Rekord von 6638 Neuinfektionen in ganz Deutschland. Der Kreis Dithmarschen meldet heute 12 neue Infektionen.
  • 20.10.2020: Der Kreis Dithmarschen überschreitet die 35-Fallmarke. Der Kreis berät sich mit dem Gesundheitsamt. Herbstmarkt darf mit umfassendem Hygienekonzept starten
  • 24.10.2020: Amtliche Bekanntmachung Nr.104 beinhaltet Maßnahmen für den ganzen Kreis Dithmarschen.
  • Am 28.10.2020 hat das Schleswig-Holsteinische Verwaltungsgericht Schleswig eine Klage abgelehnt. Das öffentliche Interesse an der Abwehr von Gesundheitsgefahren und der Sicherstellung der Gesundheitsvorsorgung überwiegt dem privaten Interesse des Antragstellers an Spaziergängen, Einkäufen und Restaurantbesuchen ohne Maske. 1 B 126/26
  • 02.11.2020: Zehn Soldaten der 8. Kompanie des Spezialpionierregiments 164 aus Husum unterstützen ab sofort das Gesundheitsamt Dithmarschen. Und es gibt mal wieder einen Lock-Down, dieses mal eine light-Version.
  • 26.11.2020: Dithmarschen unterschreitet nach langer Zeit endlich wieder die 35er-Marke beim Inzidenzwert.
  • 27.11.2020: In Deutschland gibt es jetzt mehr als 1 Million Infizierte. Die 7-Tagesinzidenz vom Kreis Dithmarschen überschreitet 35.
  • Am 29.11.2020 fiel der Inzidenzwert von Dithmarschen erneut unter 35 und liegt auch am darauf folgenden Tag drunter.
  • 02.12.2020: Niedrigster Inzidenzwert seit 17. Oktober.
  • 07.12.2020: Der Kreis Dithmarschen ist zum ersten mal ein Risiko-Gebiet. Es gab einen größeren Ausbruch in einer Alten- und Pflegeeinrichtung in Marne (mehr als 40 Fälle). Grundschüler müssen jetzt in der Schule eine Maske tragen. Die Maskenpflich gilt während des Unterrichts, während der Pausen und auf dem Weg zwischen Schule und Bushaltestelle bzw. Bahnhof.
  • 16.12.2020: Es gibt erneut einen Lock-down. Alles was nicht dringend gebraucht wird schließt und so weiter. Seit letztem Wochenende haben wir bereits ein Alkoholverbot in der Öffentlichkeit.
  • 18.12.2020: In einem Seniorendienstleistungszentrum in Tellingstedt wurden mehrere Infizierte festgestellt. Die Abstriche fanden bereits vor 2 Tagen statt. (mehr als 20 Fälle)
  • 04.01.2021: Heute eröffnete das erste Corona-Impfzentrum in Heide in der Meldorfer Straße 196. Es wurden 60 Impfungen durchgeführt.
  • 11.01.2021: In einer Alten- und Pflegeeinrichtung in Heide wurden 23 Neuinfektionen festgestellt.
  • Am 21.01.2021 bestätigt die Charité in Berlin dass in einem Haushalt in Dithmarschen die hochansteckende Mutation aus Großbritannien entdeckt wurde. Eine der 4 Sequenzen trägt den Namen BetaCoV/Dithmarschen/ChVir22551/2021. Diese Sequenz trägt das Datum 13.01.2021.
  • 05.02.2021 gegen 23 Uhr wird in Heide eine Party aufgelöst. Es waren 5 Personen aus 4 verschiedenen Haushalten anwesend.
  • 06.02.2021 gegen 17:30 Uhr wird in Wesselburen eine Party beendet. Es waren 30 Personen in einem Einfamilienhaus anwesend.
  • 13.04.2021 gegen 18 Uhr wurde in Brunsbüttel ein Testzentrum des Roten Kreuz evakuiert nachdem in einer benachbarten Halle ein Feuer ausbrach. Es waren 30 Personen im Testzentrum anwesend als das Feuer ausbrach. Es waren 40 Einsatzkräfte im Einsatz. Mit Hilfe des Löschsystems "fognail" konnte die Temperatur im inneren gesenkt werden. Ein Übergergreifen des Feuers auf das Testzentrum konnte erfolgreich verhindert werden.
  • 22.04.2021 Das Impfzentrum in Brunsbüttel verlängert bis einschließlich 02.05.2021 seine Öffnungszeiten. Es ist jetzt bis 22 Uhr geöffnet. Aufgrund eines technischen Fehlers wurden die Nachmittagstermine für diese und nächste Woche doppelt gebucht. Es kam zu über 2.000 Doppelbuchungen die in die Abendstunden verlegt werden.
  • 13.05.2021 Mit 960 Neuinfektionen im Jahr 2021 wurde heute der Vorjahreswert erreicht.
  • 21.05.2021 Dithmarscher Impfzentren knacken 50.000 Impfungen.
  • 18.08.2021 Heute hat der Kreis Dithmarschen mit 35 Neuinfektionen einen neuen Tagesrekord aufgestellt. Der bisherige Rekord vom 18.12.2020 lag nur bei 28.
  • 20.08.2021 Der neue Inzidenz-Rekord liegt bei 90,81 Infizierten je 100.000 Einwohner.
  • 10.11.2021 Mit 102,11 Neuinfektionen je 100.000 Einwohner pro Woche liegt der Inzidenzwert erstmals über 100.
  • 18.12.2021 In Meldorf findet eine Veranstaltung statt bei der sich viele Menschen infizieren. Inzidenz liegt irgendwo zwischen 80 und 90.
  • 26.12.2021 Es gibt in Dithmarschen 297 aktive Fälle von denen 75 Fälle der Omikron-Variante (B.1.1.529) zuzuordnen sind. Die Nachverfolgung der Kontaktpersonen ist kaum noch an einem Tag zu schaffen, obwohl über Weihnachten und Heiligabend 13 Mitarbeiter aus Kreis und Bundeswehr jeden Tag 12 Stunden lang im Einsatz waren.
  • 27.12.2021 Heute ist Montag. Ab heute gilt Besuchsverbot in den beiden Krankenhäusern in Brunsbüttel und Heide. Die Inzidenz steigt erstmalig über 200. Die Omikron-Variante ist jetzt 112 mal in Dithmarschen vorhanden.
  • 28.12.2021 Der neue Tagesrekord liegt bei 91 Neuinfizierten an nur einem Tag. Die Omikron-Variante ist jetzt 167 mal vorhanden.
  • 28.12.2021 late-night-impfen in Meldorf im Ärztezentrum von 19 Uhr abends bis 2 Uhr morgens.
  • 31.12.2021 Das Jahr verabschiedet sich mit einem neuen Rekord und knackt die 500er-Marke (Inzidenz). Desweiteren gibt das Pahlazzo bekannt, dass es dort am 25.12.2021 Omikron-Fälle gab und bittet alle Besucher darum, für 14 Tage in Quarantäne zu gehen.

Aktuelle Informationen findet Ihr bei Boyens Medien und auf der Facebook-Seite des Kreises Dithmarschen.

Altersverteilung der mit Corona infizierten in Dithmarschen

Alter weiblich männlich alle
0-4 13 7 20
5-14 34 42 76
15-34 146 110 256
35-59 163 142 305
60-79 96 93 189
80+ 71 41 112
alle 523 435 960
Alter weiblich männlich alle
0-4 42 56 99
5-14 233 253 489
15-34 638 659 1306
35-59 519 550 1069
60-79 186 185 371
80+ 93 63 156
alle 1.711 1.766 3.488
Alter weiblich männlich alle
0-4 86 (+13) 97 (+16) 185 (+30)
5-14 429 (+68) 424 (+52) 864 (+125)
15-34 1.268 (+95) 1.271 (+100) 2.547 (+200)
35-59 1.103 (+108) 1.092 (+125) 2.202 (+236)
60-79 372 (+23) 376 (+17) 748 (+40)
80+ 202 (+15) 125 (+6) 327 (+21)
alle 3.461 (+323) 3.386 (+317) 6.875 (+663)

Da sich die Anzahl der Personen mit unbekanntem Geschlecht manchmal ändert passen nicht immer alle Daten zusammen.

  • Hinweis: Am 07.01.2021 bzw. am Vortag gab es 3 Nachmeldungen vom 28.04.2020, 02.11.2020 und 13.11.2020. 1 Fall vom 01.01.2021 wurde storniert.
  • Hinweis: Aufgrund von Korrekturen können immer mal wieder geringfügige Abweichungen auftreten.
  • Hinweis: aktuell haben 28 Personen einen unbekannten Genderstatus. 2 haben ein unbekanntes Alter.

7-Tages-Inzidenz-Werte nach Geschlecht und Alter

Alter weiblich männlich alle
0-4 483,27 573,48 547,45
5-14 1.207,60 884,50 1.086,01
15-34 718,28 687,90 720,38
35-59 481,30 565,10 529,63
60-79 133,05 105,43 119,72
80+ 239,35 140,85 199,49
alle 478,24 482,42 497,56

Die Farbe hellgrün ist für den Wert 0,00 reserviert.
Ab 35 wird es orange.
Ab 50 wird es hellrot.
Ab 250 wird die Schriftfarbe rot.

Eigene Berechnung

Es wird jeweils das Datum von gestern angegeben, weil die Daten erst am nächsten Tag vom RKI veröffentlicht werden.


tcctcggcgggc hier kommt bald ein neues Bild hin

Ein kleiner Gen-Abschnitt macht Corona einzigartig. Anders als in allen nahen Verwandten, egal ob in Fledermaus oder Pangolin, hat Corona eine einzigartige Furin-Spaltstelle (PRRAR↓SV). Diese entstand durch eine Insertion von 12 Nukleotiden Länge. Dieser kurze Genabschnitt wurde bisher noch nicht in anderen Coronaviren gefunden.

mögliche Quellen für die Insertion

  • NM_006843.3 (309..320) Homo sapiens serine dehydrase (SDS)
  • NM_015914.7 (254..265) Homo sapiens thioredoxin domain containing 11 (TXNDC11)
  • NM_079903.4 (6.010..6.021) Drosphila melanogaster nejire (nej)
  • NM_171999.4 (2.217..2.228) Homo sapiens spalt like transcription factor 3 (SALL3)
  • NM_176832.2 (1.623..1.634) Mus musculus spire type actin nucleation factor 1 (spire1)
  • AZZ57384.1 (635..646) bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase (Rathayibacter iranicus)
  • modifiziertes Echovirus E25 zur Bekämpfung von Tumoren.
  • KP099941.1 (1.170..1.181) Echovirus E25 strain XM0297 (China: Fujian / 2013)
  • AK120063.1 (1.300..1.311) Oryza sativa Japonica Group cDNA clone:J013001K22, full insert sequence
  • ACU98579.1 (1.855..1.866) membrane carboxypeptidase (penicillin-binding protein) [Saccharomonospora viridis DSM 43017]

Echovirus E25 ist ebenfalls wie Corona ein (+)ssRNA-Virus.

Interessant ist der Genabschnitt ccaagttcctcggcgggcacggga und sein Gegenstrang tcccgtgcccgccgaggaacttgg (5' zu 3' Richtung) von Rathayibacter iranicus, ein Bakterium das Weizen krank macht. Die Endstücke gga (NGA) und tgg (NGG) werden auch als PAM bezeichnet. Die Genschere Crispr Cas9 schneidet 3 Nukleotide vor dem PAM beide DNA-Stränge durch. Damit beide Schnittstellen funktionieren müssen wir die DNA nach dem ersten Schnitt ein wenig drehen und nochmals rein stecken. Nach dem ersten Schnitt bleiben übrigens nur noch 15 Basenpaare (bp) zum vergleichen übrig, das ist jedoch ausreichend. Das natürliche Limit der Spacer liegt zwischen 15bp und 21bp.

Schnitt 1
5'-ccaagttcctcggcgggc|acggga-3' Hauptstrang
3'-ggttcaaggagccgcccg|tgccct-5' Gegenstrang

Schnitt 2
5'-gcccgccgagga|acttgg Gegenstrang
3'-cgggcggctcct|tgaacc Hauptstrang

oder anders herum.

Der Einsatz von Crispr Cas9 ist nicht sinnvoll um 12 Nukleotide auszuschneiden die in ein anderes Genom übertragen werden sollen. Es wäre jedoch möglich dass jemand eigentlich das Genom von Weizen bearbeiten wollte, dabei eine verunreinigte Probe erwischt hat und dieses Bruchstück rein zufällig entstanden ist.

Corona hat eine gültige Schnittstelle für Crispr Cas 9 direkt hinter der Insertion, aber nur wenn man vorher die RNA mit einer Reverse Transcriptase in DNA umwandelt. Mit Hilfe von Google findet man viele verschiedene PAMs, darunter auch NAG. NAG bedeutet ein beliebiges Nukleotid und A und G.

Der Genabschnitt in dem sich die Insertion befintet lautet wie folgt:


Es kann also ein gezielter Schnitt an der gewünschten Stelle durchgeführt werden. Die nur 12 Nukleotide lange Sequenz die eingebaut wird, würde man vermutlich eher selber bauen als ausschneiden, da man in der Regel auch die Spacersequenz selber bauen muss was deutlich aufwändiger wäre weil die Spacersequenz nur ein Ausschnitt eines noch längeren RNA-Strangs ist. Leider kann ich euch nicht verraten ob Corona aus einem Labor kommt oder aus welchem. Jedoch kann ich euch verraten dass man es in einem Labor herstellen kann.

Regionale Viren

Nummer Lokation Datum Nuklid-Mutationen Amminosäuren-Mutationen
3037 Kreis-Dithmarschen 17.03.2020 C241T, C3037T, C14408T, A23403G ORF1b: P314L, S: D614G
3066 Heide 20.03.2020 C241T, C1059T, C3037T, T3037C, C14408T, A23403G, G25563T ORF1ab: T265I, ORF1b: P314L, S: D614G, ORF3a: Q57H
8308 Kreis-Dithmarschen 21.07.2020 C241T, C3037T, T3169C, C6267T, G6482A, T9961C, G10265A, G10396T, G12052T, C14408T, A15972G, C16178T, C16391T, G19648T, C19718T, C22993T, A23403G, A25492G, T28759C, G28881A, G28882A, G28883C ORF1ab: A2001V, G2073R, G3334S, K3929N, ORF1b: P314L, S904L, A975V, V2061L, Q3126*, S: D614G, ORF3a: T34A, N: R203K, G204R
8315 Kreis-Dithmarschen 26.07.2020 siehe: 8317 + G24095T siehe: 8317 + S: A845S
8317 Kreis-Dithmarschen 26.07.2020 C241T, G2527A, C3037T, G3259T, C5002T, C14408T, A23403G, G23593C, A23851G, G25644T, C26447T, G28881A, G28882A, G28883C, C28887T ORF1ab: Q998H, ORF1b: P314L, S: D614G, Q677H, E: S68F, N: R203K, G204R, T205I
8318 Kreis-Dithmarschen 26.07.2020 siehe: 8317 + C1841A siehe: 8317 + ORF1ab: Q526K
8319 Kreis-Dithmarschen 26.07.2020 siehe: 8315 siehe: 8315
8325 Kreis-Dithmarschen 28.07.2020 siehe: 8317 siehe: 8317
8608 Kreis-Dithmarschen 25.08.2020 C21T, C241T, G1244A, G1464A, C3037T, T7767C, C8047T, G8179T, C13372T, C14408T, C17104T, T19242C, A20268G, C20594T, A21141G, C22879A, A23403G, C25624T, G26690T, G29734C ORF1ab: G327S, G400D, I2501T, ORF1b: P314L, H1213Y, T2376I, S: N439K, D614G, ORF3a: H78Y
9120 Kreis-Dithmarschen 17.09.2020 C241T, C2110T, C3037T, G4180T, A6442C, C6843T, C7000T, C10755T, A11755T, C14408T, C14821T, G16377T, G19656T, C22227T, A23403G, G25996T, C28603T, G28881A, G28882A, G28883C, G29706T ORF1ab: K1305N, K2059N, S2193F, A3497V, ORF1b: P314L, P452S, K2063N, S: A222V, D614G, ORF3a: V202L, N: R203K, G204R
9123 Kreis-Dithmarschen 21.09.2020 C241T, T517C, C1314T, C3037T, G7393T, C7893T, C8016T, C14408T, C18452T, T21633C, A23403G, A23923T, C25578T, G28881A, G28882A, G28883C ORF1ab: T350I, A2584V, ORF1b: P314L, A1662V, S: L24S, D614G, Q787H, N: R203K, G204R
9279 Heide 02.10.2020 siehe 8608 + C9951T, C20235T, A22879C siehe 8608 + ORF1ab: A3229V, S: K439N
9286 Heide 05.10.2020 C241T, C1684T, C2113T, G2305T, C3037T, C4927T, C8016T, C9693T, G11083T, C14408T, T15492C, C18744T, T19839C, T22156C, A23403G, C23422T, A25843G, C26111T, G28881A, G28882A, G28883C, G29405C + 4 mehr ORF1ab: K680N, A2584V, A3143V, L3606F, ORF1b: P314L, S: D614G, ORF3a: T151A, P240L, ORF8: V32L, N: R195I, R203K, G204R, E378Q
9288 Dithmarschen 05.10.2020 T224C, C241T, T445C, A408G, C3037T, A4049G, C6286T, C11747T, C14408T, G21255C, C22088T, C22227T, A23403G, 26801G, C28932T, G29645T, C29686T ORF1ab: D48G, N1262D, ORF1b: P314L, S: L176F, A222V, D614G, N: A220V, ORF10: V30L
9638 Heide 16.10.2020 siehe: 8608 + C20235T + C22450T siehe: 8608
9932 Heide 03.11.2020 C241T, T2233C, C3037T, C3117T, C7303T, T7789A, C12400T, C14408T, G19656T, T19839C, C20703T, A23403G, G27798T, C28278A, G28881A, G28882A, G28883C, G28884T ORF1ab: T951I, ORF1b: P314L, K2063N, S: D614G, ORF7b: A15S, N: S2Y, R203K, G204R, R204L
9943 Dithmarschen 03.11.2020 C241T, T1606C, C2062T, C3037T, C5184A, C6027A, C13887T, C14408T, C17430T, C18687T, C23248T, A23403G, A25574C, G28881A, G28882A, G28883C, C29367G, Lücken (“-“): 3 ORF1ab: P1640H, P1921Q, ORF1b: P314L, S: D614G, ORF3a: K61T, N: R203K, G204R, P365R
20000 Dithmarschen 04.11.2020 siehe: 9638 siehe: 9638
20001 Dithmarschen 04.11.2020 siehe: 9638 siehe: 9638
20002 Dithmarschen 04.11.2020 C241T, T445C, C3037T, C5170T, C6286T, C8160T, G11132T, C14408T, G21255C, C22227T, A23403G, G23587T, C26801G, C27982T, C28932T, G29645T ORF1ab: A3623S, ORF1b: P314L, S: A222V, D614G, Q675H, ORF8: P30L, N: A220V, ORF10: V30L
20292 Dithmarschen 12.11.2020 C241T, C313T, C3037T, A3254C, C3656T, C11339T, G14354A, C14408T, C14768T, C19488T, T22402C, A23403G, T23908C, T28009C, C28500T, G28881A, G28882A, G28883C, G29254A, G29384T ORF1ab: N997H, L1131F, ORF1b: R296K, P314L, A434V, S: D614G, ORF8: I39T, N: T76I, R203K, G204R, D371Y
20295 Dithmarschen 12.11.2020 C241T, T445C, C3037T, C4456T, C6286T, C12119T, C14408T, A21222T, G21255C, C22227T, A23403G, C25889T, C26801G, C27944T, C28932T, G29645T ORF1ab: P3952S, ORF1b: P314L, S: A222V, D614G, ORF3a: S166L, N: A220V, ORF10: V30L
20299 Heide 13.11.2020 C241T, C774T, C3037T, A3938C, C6445T, C6636T, C7564T, C9611T, C14408T, C18687T, A23403G, C25378T, G28881A, G28882A, G28883C, A29735G ORF1ab: T170I, T2124I, L3116F, ORF1b: P314L, S: D614G, N: R203K, G204R
20313 Dithmarschen 16.11.2020 C241T, T445C, C3037T, C6286T, C12119T, C14408T, A21222T, G21255C, C22227T, A23403G, C25889T, C26801G, C27944T, C28932T, C29420T, G29645T ORF1ab: P3952S, ORF1b: P314L, S: A222V, D614G, ORF3a: S166L, N: A220V, P383S, ORF10: V30L
20775 Dithmarschen 26.11.2020 C28T, C241T, C2062T, C2268T, C3037T, A3703G, C5184A, T6023C, C7609T, G12824A, T13417C, C13887T, G14055T, C14408T, C18687T, C23248T, A23403G, C25777T, G26062T, G28881A, G28882A, G28883C, C29754T ORF1ab: A668V, P1640H, Y1920H, D4187N, ORF1b: P314L, S: D614G, ORF3a: L129F, G224C, N: R203K, G204R
20789 Brunsbuettel 02.12.2020 siehe: 20002 + C29167T siehe: 20002
20798 Brunsbuettel 02.12.2020 C241T, T445C, C3037T, C6286T, C9679T, C14408T, C19718T, G21255C, C22227T, G23311T, A23403G, C26801G, C27944T, C28932T, A29526T, G29543T, G29645T ORF1b: P314L, T2084I, S: A222V, E583D, D614G, N: A220V, Q418L, ORF10: V30L
20810 Heide 01.12.2020 C241T, C1218T, C3037T, C3602T, C6941T, C8645T, G11083T, C14408T, C15324T, A16044T, C20790T, C21855T, C22993T, A23403G, A25505G, G25906C, G25996T, C26907G, C28651T, C28869T, Lücken (“-“): 3 ORF1ab: S318L, H1113Y, H2794Y, L3606F, ORF1b: P314L, S: S98F, D614G, ORF3a: Q38R, G172R, V202L, M: L129V, N: P199L
20835 Dithmarschen 30.11.2020 siehe: 20789 siehe: 20789
20845 Heide 03.12.2020 siehe: 9932 + G27762C siehe: 9932 + ORF7b: E3Q
20846 Dithmarschen 03.12.2020 siehe: 21113 + G2051T, G16710A siehe: 21113 + ORF1ab: V596F
21105 Brunsbuettel 03.12.2020 siehe: 20798 siehe: 20798
21113 Dithmarschen 17.11.2020 siehe: 9932 + G1599A, C5157T, C29585T siehe: 9932 + ORF1ab: G445D, A1631V, ORF10: P10S
21122 Dithmarschen 05.12.2020 C241T, T445C, C3037T, C6286T, C9679T, C14408T, G21255C, C22227T, G23311T, A23403G, C26801G, C26895T, C27944T, C28932T, A29526T, G29543T, G29645T ORF1b: P314L, S: A222V, E583D, D614G, M: H125Y, N: A220V, Q418L, ORF10: V30L
21123 Dithmarschen 05.12.2020 siehe: 20789 siehe: 20789
21125 Dithmarschen 05.12.2020 siehe: 20789 siehe: 20789
21128 Dithmarschen 05.12.2020 siehe: 20789 siehe: 20789
21144 Heide 07.12.2020 C241T, C2416T, C3037T, G8371T, C9430T, C14408T, A15477T, G17252A, C18395T, A20622T, G20623T, A20624T, A23403G, C23525T, C23730T, G25563T, G25691A, A26319G, C28854T + 1 mehr ORF1ab: Q2702H, ORF1b: P314L, R1262H, A1643V, K2385N, D2386F, S: D614G, H655Y, T723I, ORF3a: Q57H, G100D, N: S194L
21459 Dithmarschen 17.12.2020 siehe: 20789 + T10A, C19688A, T20004C, A23145T siehe: 20789 + S: K528I
21737 Dithmarschen 22.12.2020 siehe: 21780 + C29167T siehe: 21780
21780 Dithmarschen 25.12.2020 C222T, C241T, T445C, C3037T, C6286T, C9565T, C14408T, G18651T, T20661C, G21255C, C22227T, A23403G, G25634T, C26801G, C28932T, C29366T, C29386T, G29645T ORF1b: P314L, E1728D, S: A222V, D614G, ORF3a: C81F, N: A220V, P365S, ORF10: V30L
21794 Heide 26.12.2020 C241T, C829T, C3037T, C5175T, T7767C, C8047T, A10108G, T11459G, G12988T, C13381T, C14408T, C14697T, G15598A, C16394T, C17104T, G18028T, C18176T, G19398T, A20268G, C22127T, C22879A, A23403G, G23876A, T24910C, G25947T, G26951T, T26972C, C27800A, G28083T, G29734C, Lücken (“-“): 6 ORF1ab: T1673I, I2501T, S3732A, M4241I, ORF1b: P314L, V711I, P976L, H1213Y, A1521S, P1570L, E1977D, S: H69-, L189F, N439K, D614G, V772I, ORF3a: Q185H, ORF8: E64*
21796 Dithmarschen 26.12.2020 siehe: 9288 + T13C, G1590T, C8293T, C20233T, C29762T siehe: 9288 + ORF1ab: G422V, ORF1b: P2256S
21806 Dithmarschen 26.12.2020 C241T, A604G, C3037T, C3096T, T7819T, C12053T, C12439T, C12830A, G13849T, C14408T, A19020T, T19839C, C19839T, G21974T, G22992A, A23403G, A26741G, C27612T, G28881A, G28882A, G28883C + 2 mehr, Lücken (“-“): 6 ORF1ab: S944L, L3930F, Q4189K, ORF1b: G128C, P314L, S: D138Y, S477N, D614G, M: I73M, ORF8: S67-, N: R203K, G204R
21813 Dithmarschen 26.12.2020 siehe: 9288 + T13C, G1590T, C20233T, C29762T siehe: 9288 + ORF1ab: G422V, ORF1b: P2256S
22551 Dithmarschen 13.01.2021 C241T, C913T, C3037T, C3267T, C5388A, C5986T, T6954C, 11288-11296 del, A12162G, A13015G, C14408T, C14676T, C15279T, T16176C, A17615G, 21765-21770 del, 21991-21993 del, A23063T, C23271A, A23403G, C23604A, C23709T, T24506G, G24914C, C27972T, G28048T, A28111G, G28280C, A28281T, T28282A, G28881A, G28882A, G28883C, C28977T ORF1ab: T1001I, A1708D, I2230T, S3675-, G3676-, F3677-, Q3966R, ORF1b: P314L, K1383R, S: H69-, V70-, Y144-, N501Y, A570D, D614G, P681H, T716I, S982A, D1118H, ORF8: Q28*, R52I, Y73C, N: D3L, R203K, G204R, S235F

Die Nummer 3037 mit der Lokation Kreis-Dithmarschen entspricht dem vollständigen Namen BetaCoV/Kreis-Dithmarschen/ChVir3037/2020 mit der Accession CSpecVir3037.

Wir danken den folgenden Autoren aus den Ursprungslabors, die für die Beschaffung der Proben verantwortlich sind, und den Einreichungslabors, in denen genetische Sequenzdaten generiert und über die GISAID-Initiative ausgetauscht wurden, auf der diese Forschung basiert. Wir danken auch für Sequenzen die noch nicht bei GISAID angekommen sind.

Virusname Accession Collection Date originating lab submitting lab Authors
Wuhan/Hu-1/2019 EPI_ISL_402125 26.12.2019 National Institute for Communicable Disease Control and Prevention (ICDC) Chinese Center for Disease Control and Prevention (China CDC) National Institute for Communicable Disease Control and Prevention (ICDC) Chinese Center for Disease Control and Prevention (China CDC) Zhang et al
Alle regionalen Viren A. Krumbholz, Labor Dr.Krause und Kollegen MVZ GmbH, Kiel Charité Universitätsmedizin Berlin, Institut für Virologie Victor M Corman, Barbara Mühlemann, Jörn Beheim-Schwarzbach, Talitha Veith, Julia Schneider, Terry Jones, Christian Drosten

Überregionale Mutationen

Am Jahresende des Jahres 2020 wurden in 3 Ländern auf 3 Kontinenten hochansteckende Mutanten entdeckt die völlig unabhängig voneinander entstanden sind. Auffällig an diesen Mutanten ist dass diese viele Mutationen im Spike-Protein aufweisen. In Südafrika entstand ein Stamm, auch Clade genannt, mit der Bezeichnungen 20H auch 501Y.V2 oder B.1.351 genannt. In Großbritannien entstand die Clade 20I auch 501Y.V1 oder B.1.1.7 genannt. In Brasilien entstand die Clade 20J auch 501Y.V3 oder P.1 genannt.

Es gibt verschiedene Gemeinsamkeiten. Die beiden Claden 20H und 20J haben unter anderem die Spike-Mutation E484K gemeinsam, die dafür verantwortlich gemacht wird, dass sich bereits Genesene erneut anstecken können. An Position 417 des Spike-Proteins haben zwar beide eine Mutation diese sind jedoch nicht identisch. 20H weist die Mutation K417N während 20J die Mutation K417T aufweist. Alle drei Zweige weisen die Mutation N501Y auf die für eine hohe Ansteckungsrate verantwortlich gemacht wird.

Die SGF-Deletion

Eine weitere Übereinstimmung in allen 3 Zweigen ist die Löschung der Aminosäuren SGF an Position 3675-3677 von ORF1a, was der Position 106-108 im Nichtstrukturprotein 6 (nsp6) entspricht. Auch diese Mutation könnte interessant sein, da nsp6 die Fähigkeit besitzt Autophagosomen aus dem endoplasmatischen Retikulum zu erzeugen. Autophagosomen können die Infektion fördern, indem sie den Aufbau von Replikase-Proteinen erleichtern. Nsp6 reduziert die Größe der Autophagosomen unabhängig davon ob diese selbst produziert sind oder nicht, dies beeinträchtigt die Fähigkeit der Autophagosomen virale Komponenten zum Abbau an Lysosomen abzugeben.

Inzwischen tritt diese Mutation in weiteren hochansteckenden Mutationen auf. Durch diese Mutation geht das Epitop mit der Sequenz TSLSGFKLK verloren. Eigentlich kann man sagen dass noch viele andere übrig bleiben, jedoch hat das relativ kleine nsp6-Protein jetzt eine Angriffsstelle weniger.

Das humane Immunsystem

Allele Score
HLA-A*11:01 0,786644
HLA-A*34:02 0,681343
HLA-A*03:01 0,480981
HLA-A*30:01 0,465776
HLA-A*68:01 0,364416
HLA-A*31:01 0,199178
HLA-A*33:01 0,028022
HLA-A*30:02 0,014891
HLA-B*57:01 0,010234
HLA-A*01:01 0,004961
HLA-B*58:01 0,004472
HLA-A*32:01 0,002864
HLA-A*26:01 0,001222
HLA-A*68:02 0,000595
HLA-B*51:01 0,000493
HLA-A*02:06 0,000489
HLA-B*15:01 0,000375
HLA-B*35:01 0,000217
HLA-B*44:03 0,000177
HLA-B*44:02 0,000160
HLA-B*53:01 0,000137

Es ist empfehlenswert den Link anzuklicken um den Rest besser zu verstehen. Grundlagen der Immunologie PDF

Beide Eltern vererben jeweils 1 Allel für HLA-A,B und C. Wir haben also nicht die komplette Liste sondern von jedem nur 2. Es hat so ziemlich jeder ein individuelles Immunsystem. Wer nach einer Kopie seines eigenen Immunsystems sucht sollte am besten in der eigenen Familie anfangen da 2 Eltern nur 4 verschiedene Immunsysteme vererben können.

Ein Epitop ist eine Gensequenz die sich im Fremdkörper zum Beispiel einem Virus befindet. Jedes Allel hat eine eigene Liste mit Sequenzen die unterschiedlich gut erkannt werden.

Je höher der Score desto bessere Antikörper werden gebildet. Als Beispiel habe ich das Epitop TSLSGFKLK ausgewählt.

The MHCI binding predictions were made on 3/12/2021 using the IEDB analysis resource NetMHCpan (ver. 4.1) tool [1].

1. Birkir Reynisson, Bruno Alvarez, Sinu Paul, Bjoern Peters, Morten Nielsen. 2020. NetMHCpan-4.1 and NetMHCIIpan-4.0: improved predictions of MHC antigen presentation by concurrent motif deconvolution and integration of MS MHC eluted ligand data. Nucleic Acids Res. 48(W1):W449-W454. doi: 10.1093/nar/gkaa379.



Manchmal kommt es vor, dass Amminosäuresequenzen von verschiedenen Viren übereinstimmen. Es kann deshalb vorkommen dass sich, wenn man sich mit einem Virus infiziert, Antikörper gegen ein anderes Virus, das man schon einmal gehabt hat, entwickeln. Manchmal hat man Glück und man ist gegen dieses neue Virus immun, aber es kann auch vorkommen, dass nur wenige Antikörper passen und wir sozusagen die falschen Antikörper produzieren.

Gemeinsamkeiten Corona und OC43 ab 9aa Länge
Protein Sequenz Länge
nsp4 wvlnndyyrslpg 13
gsdvlyqpp 9
nsp5 tlnglwldd 9
vycprhvic 9
nsp12 kkdwydfvenpdi 13
vgvltldngdlng 13
ifvdgvpfvvs 11
fqtvkpgnfn 10
tqmnlkyaisaknrartvagvsi 23
lksiaatrg 9
lmgwdypkcdrampn 15
rfyrlanecaqvlse 15
yvkpggtssgdatta 15
ansvfnicqav 11
khfsmmilsdd 11
vlyyqnnvfmse 12
gphefcsqhtmlvk 14
psrilgagcfvdd 13
ierfvslaidaypl 14
nsp13 lcckccydhv 10
pyvcnapgcdv 11
lylggmsyyc 10
cterlklfaaet 12
lsaptlvpqe 10
gppgtgksh 9
shaavdalceka 12
rakhyvyigdpaqlpapr 18
eivdtvsalvy 11
kavfispynsqn 12
qgseydyv 9
nvnrfnvaitrak 13
nsp14 plqlgfstg 9
qfkhliplm 9
daimtrclav 10
vcrfdtrvl 9
ggslyvnkhafht 13
dyvplksatcitrcnlggavc 21
nsp15 gglhlligl 9
nsp16 mmnvakytqlcqylnt 16
tlaypynmrv 10
wdliisdmydp 11
klalggsvaikite 14

Außerhalb vom Polyprotein fand ich bisher nur einen Treffer im Nukleokapsid-Protein, und zwar PRWYFYYLGTGP. Ich halte es für unwahrscheinlich dass ich noch mehr finde.

Impfstoffe gegen Covid-19

Comirnaty (BNT162b2, Biontec / Pfizer)

Der Impfstoff Comirnaty von Biontec und Pfizer ist ein mRNA-Impfstoff. Das Verfahren ist noch relativ neu. Anstelle von abgeschwächten Viren oder leeren Hüllen usw. wird ein Bauplan des Spike-Proteins gespritzt. (Das Spike-Protein befindet sich an der Virenhülle und dockt am ACE2-Receptor an.) Der Bauplan besteht aus mRNA, diese wird in den Zellen des geimpften ausgelesen und nach dieser Anleitung ein Protein des Zielerregers (das Spike-Protein) gebaut, das dann eine Immunreaktion bewirkt. Der Bauplan wird vorher noch optimiert indem die Codonhäufigkeit an den Wirt angepasst wird, so dass die Produktion des Spike-Proteins möglichst einfach ist. Das scheint gut zu funktionieren. In einer Untersuchung in den USA mit 195 Probanden im Alter von 18 bis 85 Jahren erreichten die jüngeren Teilnehmer (18 bis 55 Jahre) nach zweimaliger Impfung Antikörperkonzentrationen die 3,8 mal so hoch waren wie bei ungeimpften Personen, die eine echte Infektion durchgemacht hatten. Bei älteren Probanden (65 bis 85 Jahren) waren noch etwa 1,6 mal so viele Antikörper vorhanden. Neben der Antikörper-Antwort induzierte BTN162b2 auch eine ausgeprägte CD4+- und CD8+-T-Zellreaktion gegen die Rezeptorbindungsdomäne und den Rest des Spike-Proteins.

Der Impfstoff wird in 2 Einzeldosen zu je 30µg im Abstand von 21 Tagen verabreicht. Der Impfstoff wird intramuskulär in den Deltamuskel verabreicht. Das Volumen einer Dosis beträgt 0,3 ml. Bevor der Impfstoff verabreicht wird, wird dieser aufgetaut und verdünnt. Ein Schutz gegen das Virus ist 7 Tage nach der zweiten Dosis vorhanden. Die Wahrscheinlichkeit sich nach der Impfung mit Covid-19 zu infizieren ist um 95% reduziert.

Der Impfstoff ist bei -75°C maximal 6 Monate haltbar, im Kühlschrank bei 2°C bis 8°C maximal 5 Tage und bei Raumtemperatur bei 2°C bis 30°C maximal 2 Stunden. Nachdem der Impfstoff verdünnt ist, ist er bei Raumtemperatur bei 2°C bis 30°C maximal 6 Stunden haltbar.


  • ALC-0315: ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)
  • ALC-0159: 2[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide
  • 1,2-Distearoyl-sn-glycero-3-phosphocholin
  • Cholesterol
  • Kaliumchlorid
  • Natriumchlorid (Kochsalz)
  • Kaliumdihydrogenphosphat
  • Dinatriumhydrogenphosphat-Dihydrat
  • Saccharose (Haushaltszucker)

Eine Dosis enthält 39 mg Kalium und 23 mg Natrium.

16-55 Jahre >55 Jahre
Dose 1 Dose 2 Dose 1 Dose 2
Vakzine Plazebo Vakzine Plazebo Vakzine Plazebo Vakzine Plazebo
Schmerzen an der Injektionsstelle 83 14 78 12 71 9 66 8
Rötung 5 1 6 1 5 1 7 1
Schwellung 6 0 6 0 7 1 7 1
Fieber 4 1 16 0 1 0 11 0
Ermüden 47 33 59 23 34 23 51 17
Kopfschmerzen 42 34 52 24 25 18 39 14
Schüttelfrost 14 6 35 4 6 3 23 3
Erbrechen 1 1 2 1 0 1 1 0
Durchfall 11 12 10 8 8 7 8 6
Muskelschmerzen 21 11 37 8 14 8 29 5
Gelenkschmerzen 11 6 22 5 9 6 19 4


Der Impfstoff mRNA-1273 von Moderna ist ebenfalls ein mRNA-Impfstoff.


AZD1222 ist ein Vektorimpfstoff. Ein Vektorimpfstoff ist ein gentechnisch veränderter Organismus. AZD1222 besteht aus einem harmlosen Virus der sich nicht vermehren kann und Spike-Proteine des neuartigen SARS-CoV-2-Virus produziert. Als Vektor wird Chimpanzee Adenovirus Y25 verwendet, ein Virus das normalerweise Chimpansen befällt. Menschen haben eher selten Kontakt zu dem Vektorvirus. Um einen wirksamen Impfstoff herzustellen benötigt man einen Vektor gegen den wir noch keine Antikörper gebildet haben. Wir müssen auch aufpassen dass wir nach der Erstimpfung möglichst wenig oder keine Antikörper gegen die Zweitimpfung entwickeln. Wenn wir Antikörper gegen Chimpansen-Viren entwickeln kann es vorkommen dass unser Immunsystem so sehr ausgelastet ist dass keine freien Ressourcen für die Spike-Proteine übrig bleiben.

Johnson & Johnson

Ad26.COV2.S von Johnson & Johnson ist ein Vektorimpfstoff.

Häufigkeit der Symptome in Deutschland

häufige Symptome:

  • Husten 45%
  • Fieber 38%
  • Schnupfen 20%
  • Störung des Geruchs- und/oder Geschmackssinns 15%
  • Pneumonie 3,0%

weitere Symptome:

  • Halsschmerzen
  • Atemnot
  • Kopf- und Gliederschmerzen
  • Appetitlosigkeit
  • Gewichtsverlust
  • Übelkeit
  • Bauchschmerzen
  • Erbrechen
  • Durchfall
  • Konjunktivitis
  • Hautausschlag
  • Lymphknotenschwellung
  • Apathie
  • Somnolenz

SARS-CoV-2 Steckbrief zur Coronavirus-Krankheit-2019 (COVID-19) Stand: 2.10.2020

Asymptomatische Fälle

Es kommt manchmal vor dass Infizierte gar keine Symptome haben, das passiert aber eher selten. Wenn man ganz viele positive Testergebnisse hat wird man feststellen dass ungefähr 20% gar keine Symptome haben. Die Wahrscheinlichkeit dass dieser Wert zwischen 17% und 25% liegt beträgt 95%. Allerdings befinden sich einige noch in der Inkubationsphase und sind daher eher als präsymptomatisch einzustufen. Wartet man auf das Ende der Inkubationsphase fällt der Anteil der Asymptomatischen auf 17,9%. Mit einer Wahrscheinlichkeit von 95% wird dieser Wert zwischen 15,5% und 20,2% liegen.

Risikogruppen für schwere Verläufe

  • ältere Personen (mit stetig steigendem Risiko für einen schweren Verlauf ab etwa 50-60 Jahren; 86% der in Deutschland an COVID-19 Verstorbenen waren 70 Jahre alt oder älter [Altersmedian: 82 Jahre])
  • Männliches Geschlecht
  • Raucher (schwache Evidenz)
  • stark adipöse Menschen
  • Personen mit bestimmten Vorerkrankungen, ohne Rangfolge
  • des Herz-Kreislauf-Systems (z.B. koronare Herzerkrankung und Bluthochdruck)
  • chronische Lungenerkrankungen (z.B. COPD)
  • chronische Nieren- und Lebererkrankungen
  • Patienten mit Diabetes mellitus (Zuckerkrankheit)
  • Patienten mit einer Krebserkrankung
  • Patienten mit geschwächtem Immunsystem (z.B. aufgrund einer Erkrankung, die mit einer Immunschwäche einhergeht oder durch die regelmäßige Einnahme von Medikamenten, die die Immunabwehr beeinflussen und herabsetzen können, wie z.B. Cortison)

SARS-CoV-2 Steckbrief zur Coronavirus-Krankheit-2019 (COVID-19) Stand: 2.10.2020

Sterblichkeit nach Altersgruppen

  • 35-44: so gefährlich wie eine Influenza
  • 45-54: 0,2%
  • 55-64: 0,7%
  • 65-74: 2,2% / 30mal so gefährlich wie eine Influenza
  • 75-84: 7,3%
  • >85 : etwa 33% / vergleichbar mit Pocken im Mittelalter

Ältere Menschen, deren Körper im Laufe ihres Lebens schon viele verschiedene Krankheits-Erreger bekämpft haben, greifen auf die bisher bekannte Immun-Erfahrung zurück. Diese Antwort auf das Virus ist dann nicht immer richtig und es kann zu schweren Verläufen der Krankheit kommen. Jüngere Menschen die weniger Krankheiten durchgemacht haben, können gezielter auf das Virus reagieren

Virologe Drosten erklärt Darum ist das Coronavirus für alte Menschen so gefährlich

Schutzmaßnahmen gegen Corona

  • Waschen Sie sich häufig die Hände. Verwenden Sie Wasser und Seife oder ein Händedesinfektionsmittel auf Alkoholbasis. Seife und Alkohol helfen weil die Virionen neben einer Proteinhülle auch eine Fetthülle haben, das macht das Virus anfällig für äußere Einflüsse.
  • Halten Sie einen Sicherheitsabstand von Personen ein, die husten oder niesen. Es ist eigentlich immer sinnvoll Abstand zu halten, da es sogenannte Superspreader gibt die schon beim normalen Atmen ähnliche Mengen an Virionen emittieren wie andere beim Husten oder Niesen.
  • Tragen Sie eine Maske, wenn Sie keinen Abstand halten können.
  • Berühren Sie nicht die Augen, die Nase oder den Mund.
  • Bedecken Sie Nase und Mund beim Husten oder Niesen, oder husten oder niesen Sie in Ihre Armbeuge.
  • Bleiben Sie zu Hause, wenn Sie sich krank fühlen.
  • Wenden Sie sich an einen Arzt, wenn Sie Fieber, Husten oder Schwierigkeiten beim Atmen haben.
  • Rufen Sie in der Arztpraxis an, bevor Sie sie aufsuchen.
  • Vermeiden Sie den Aufenthalt in Risikogebieten.

Wirksamkeit von Maßnahmen

Abstand Gesichtsmaske Augenschutz
angepasste Studien 9 10
Teilnehmer 7.782 2.647
nicht angepasste Studien 29 29 13
Teilnehmer 10.736 10.170 3.713
Relativer Effekt (95% CI)
aOR 0,18 (0,09 bis 0,38) 0,15 (0,07 bis 0,34)
nicht angepasste RR 0,30 (0,20 bis 0,44) 0,34 (0,26 bis 0,45) 0,34 (0,22 bis 0,52)
Erwartete absolute Wirkung
(95% CI)
Vergleichsgruppe kürzere Distanz 12,8% keine Gesichtsmaske 17,4% kein Augenschutz 16,0%
Interventionsgruppe weiterer Abstand
2,6% (1,3 bis 5,3)
3,1% (1,5 bis 6,7)
5,5% (3,6 bis 8,5)
CI = Konfidenzintervall
aOR = angepasstes Quotenverhältnis
RR = Relatives Risiko

Eine physikalische Entfernung von mehr als 1 m führt wahrscheinlich zu einer starken Verringerung der Virusinfektion. Pro 1 m weiter entferntem Abstand kann sich der relative Effekt um das 2,0-fache erhöhen.

Medizinische oder chirurgische Gesichtsmasken können zu einer starken Verringerung der Virusinfektion führen. N95-Atemschutzgeräte können im Vergleich zu chirurgischen oder ähnlichen Masken mit einer größeren Risikominderung verbunden sein.

Augenschutz kann zu einer starken Verringerung der Virusinfektion führen.

Ablauf einer Ansteckung

Es gibt Menschen die krank sind ohne es zu wissen, diese können überall sein. Atmet ein Mensch Viren aus so kann es vorkommen dass andere Menschen dieses Virus aufnehmen ohne das zu bemerken. Die Virionen dringen meistens über Mund und Nase in den Körper ein. Ist das Virus erst einmal in den Körper eingedrungen sucht es nach einer geeigneten Wirtszelle. Diese Wirtszellen können sich nicht nur in Lunge und Rachen und anderen Orten befinden sondern auch in der Nase weshalb eine Maske die unter der Nase getragen wird genau so wenig hilft wie keine Maske. Wenn das Virus eine passende Wirtszelle gefunden hat dockt es mit hilfe des Spike-Glycoprotein an den ACE2-Rezeptor der Wirtszelle an. Anschließend trifft dann die transmembrane Serinprotease TMPRSS2 die fatale Entscheidung dass das Virus in die Zelle eindringend darf. Kaum eingedrungen setzt dann das Virus seine RNA frei die dann einfach kopiert wird. Es werden zusätzlich noch viele Proteine produziert und die Produktion wirtseigener Proteine wird blockiert. Sobald dann fertige Virionen vorhanden sind verlassen diese dann die Wirtszelle und suchen sich neue Wirtszellen und vermehren sich dann exponentiell. Die Virionen sind in der Lage den Körper wieder zu verlassen noch bevor der Wirt seine ersten Symptome bemerkt. Manche Menschen bleiben sogar ganz von Syptomen verschont und können trotzdem ansteckend sein.

Corona: Wie hoch ist die Ansteckungsgefahr durch Aerosole?

Haltbarkeit von Coronaviren

Leider sind Daten zur Haltbarkeit von SARS-CoV-2 nur schwer zu finden deshalb findet ihr hier ein paar ähnliche Viren.

SARS-CoV Stamm P9 bei Raumtemperatur und 105 TCID 50 / ml

Oberfläche Dauer
Papier 4-5 Tage
Metall 5 Tage
Holz 4 Tage
Glas 4 Tage
Plastik 4 Tage

SARS-CoV Stamm GvU6109 bei Raumtemperatur

Oberfläche Inokulum Dauer
Papier 104 < 5 min
105 3 Stunden
106 24 Stunden
Einwegkleid 104 1 Stunde
105 24 Stunden
106 2 Tage
Baumwollkleid 104 5 Minuten
105 1 Stunde
106 24 Stunden

MERS-CoV Stamm HCoV-EMC2012 auf Kupfer bei 105 TCID 50 / ml

Temperatur Dauer
4°C >= 28 Tage
20°C 48 Stunden
30°C 8-24 Stunden

Der PCR-Test

Prä-Analytik (= Vorbereitung der Testprobe)

Die Vorbereitung umfasst die Probenentnahme, die Probenlagerung und den Transport der Proben. In der Regel wird ein Nasen- oder Mund-Rachen-Abstrich gemacht und das Abstrichbürstchen in einem Röhrchen mit einer Transportflüssigkeit oder trocken verschlossen. Anschließend wird das Röhrchen ins Labor gebracht.

Wichtig dabei ist neben der Lagerung der Probe vor allem die Abstrichtechnik. Diese ist entscheidend, da hiermit festgelegt wird, wieviel Zellmaterial und somit auch wieviel Viren aufgenommen werden. Das Robert Koch-Institut (RKI) hat Hinweise zum Probenmaterial veröffentlicht und Abstrich-Zentren, Analyselabore und Kliniken haben sogenannte „Standard Operating Protokols“ (SOPs) herausgegeben. Das sind Handlungsanweisungen, die die Abstrich-Technik, die Aufbewahrung und den Transport der Proben genau beschreiben, um so die Qualität des gesamten Verfahrens zu sichern.

Technische Analytik (= Durchführung der PCR)

Zum Nachweis des Virus dient die Polymerasekettenreaktion (Polymerase Chain Reaction). Diese Technik wurde von Kary Mullis entwickelt, der dafür 1983 den Nobelpreis für Chemie bekam.

Zuerst wird das Erbgut des Erregers aus dem Abstrichmaterial isoliert und aufgereinigt. Dann wird die RNA in DNA überführt, das macht man mit einer Enzymreaktion, die man als „reverse Transkription“ (RT) bezeichnet. Anschließend kann dann die Polymerasekettenreaktion gestartet werden.

Die DNA wird erhitzt wodurch sich die beiden Stränge der DNA trennen. Nach dem Abkühlen binden die beiden Primer an ihre jeweils genau panssenden Regionen innerhalb der DNA-Kopie. Dabei ist die Lage der Primer so gewählt, dass sie sich „gegenüberstehen“ und nur einen kleinen Teil der DNA-Kopie vermehren. In dem Reaktionsgefäß enthalten ist ein hitzebeständiges Enzym (eine sogenannte Polymerase), die die „Enden“ der Primer erkennt und diese verlängert. Dadurch entstehen jetzt zwei DNA-Kopien. Dieser Zyklus wird jetzt mehrfach wiederholt, wobei sich die DNA immer wieder verdoppelt.

Post-Analytik (= Beurteilung des PCR Ergebnisses)

Beurteilung des Ergebnisses: Mit der technischen Beurteilung einer PCR über oder unter der Nachweisgrenze wird dann eine medizinische Befundung durchgeführt. In diesem Schritt wird das technische Ergebnis in den klinischen Zusammenhang gestellt . Ist das Ergebnis zweifelhaft, weil z.B. nur ein Genabschnitt von zwei oder drei im Testsystem nachzuweisenden erfolgreich vervielfältigt wurde, dann wird der Test mit einem PCR-Test eines anderen Herstellers wiederholt oder es wird eine neue Probe des Patienten angefordert. Erst wenn das Testergebnis technisch einwandfrei ist, wird es für den Befund herangezogen.


Aus der beschriebenen technischen und medizinischen Beurteilung ergibt sich eine hohe klinisch-diagnostische Sensitivität für SARS-CoV-2 von nahezu 100 %. Die vom RKI gemeldeten Daten zum Infektionsgeschehen spiegeln somit medizinische Befunde und keine rohen Testergebnisse wieder, so dass von einer sehr hohen Zuverlässigkeit der Analysemethode auszugehen ist.


mehr zum Thema testen

Real Time Quantitative PCR

Die quantitative Echtzeit-PCR ist eine Vervielfältigungsmethode für Nukleinsäuren, die auf dem Prinzip der herkömmlichen Polymerase-Kettenreaktion (PCR) beruht und zusätzlich die Quantifizierung der gewonnenen DNA ermöglicht. Es gibt verschiedene Möglichkeiten einen Test durchzuführen. Der hier beschriebene Test basiert auf dem Förster-Resonanzenergietransfer (FRET). Eine häufig genutzte Möglichkeit des FRET besteht in der Anwendung einer TaqMan-Sonde (auch Hydrolyse-Sonde), die am 3'-Ende mit einem Quencher (z.B. TAMRA oder BHQ1), und am 5'-Ende mit einem Reporter-Fluoreszenzfarbstoff (z.B. FAM) markiert wurde. Wenn die Taq-Polymerase, die zusätzlich zur Polymeraseaktivität eine 5'-3'-Exonuklease-Aktivität besitzt, die Sonde während der Synthese des Gegenstranges am 5'-Ende abbaut, entfernen sich dadurch Quencher und Fluorophor voneinander, und eine steigende Reporter-Fluoreszenz kann gemessen werden. Die Messung findet am Ende der Elongation in jedem Zyklus statt. Wenn sich Quencher und Reporter-Fluoreszenzfarbstoff annähern nimmt der Quencher dem Reporter-Fluoreszenzfarbstoff Energie weg. Der Reporter-Fluoreszenzfarbstoff verliert Leuchtkraft und der Quencher gewinnt Leuchtkraft.

Anmerkungen zur Tabelle: Die Primer sehen in der Regel folgendermaßen aus 5'-CCCTGTGGGTTTTACACTTAA-3'. TaqMan-Sonden können unter anderem so aussehen: 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3'. FAM und BHQ1 sind Farbstoffe, davon gibt es eine größere Auswahl. Manchmal steht bei Bemerkungen invertiert, das bedeutet bei TaqMan-Sonden dass die Sequenz nicht im Virus vorhanden ist sondern dem entspricht was dort am besten ran passt. Bei den Reverse Primern ist es das Gegenstück zum Primer das mit dem Code des Virus verglichen werden kann. Wenn da steht erlaubt ... bedeutet dies das eine oder mehrere Mutationen toliert werden oder nicht vorhanden sein müssen damit der Test positiv ist. Wenn da steht benötigt ... werden die aufgelisteten Mutationen tatsächlich benötigt für ein positives Ergebnis. Hierbei steht / jeweils für oder. Original ist der Code der im Virus steht. Die Referenz-Sequenz ist Wuhan/Hu-1/2019.

Sequenz Position Bemerkungen Quellen
Human RNase P internal control Forward Primer AGA TTT GGA CCT GCG AGC G 50-68 1
Reverse Primer GAG CGG CTG TCT CCA CAA GT 95-114
ORF1a-4 Forward Primer GGC TTA CCG CAA GGT TCT TC 613-632 4
Reverse Primer TGC TAT GTT TAG TGT TCC AGT TTT C 740-764
TaqMan-Sonde AAG GAT CAG TGC CAA GCT CGT CGC C 701-725 invertiert
ORF1a-3 Forward Primer CCG CAA GGT TCT TCT TCG TAA G 619-640 4
Reverse Primer TGC TAT GTT TAG TGT TCC AGT TTT C 740-764
TaqMan-Sonde AAG GAT CAG TGC CAA GCT CGT CGC C 701-725 invertiert
ORF1a Forward Primer AGA AGA TTG GTT AGA TGA TGA TAG T 3193-3217 4
Reverse Primer TTC CAT CTC TAA TTG AGG TTG AAC C 3286-3310
TaqMan-Sonde TCC TCA CTG CCG TCT TGT TGA CCA 3229-3252 invertiert
RdRp gene / nCoV_IP2 Forward Primer ATG AGC TTA GTC CTG TTG 12690-12707 3, 4
Reverse Primer CTC CCT TTG TTG TGT TGT 12780-12797
TaqMan-Sonde AGA TGT GCT GCC GGT A benötigt T12722A + C12723G + T12724A
TCT TGT GCT GCC GGT A 12722-12737 original
SARS-CoV-2 ORF1ab Forward Primer CCC TGT GGG TTT TAC ACT TAA 13342-13362 1, 2, 4
Reverse Primer ACG ATT GTG CAT CAG CTG A 13442-13460
TaqMan-Sonde CCG TCT GCG GTA TGT GGA AAG GTT ATG G 13377-13404
RdRp gene / nCoV_IP4 Forward Primer GGT AAC TGG TAT GAT TTC G 14080-14098 3, 4
Reverse Primer CTG GTC AAG GTT AAT ATA GG 14167-14186
TaqMan-Sonde TCA TAC AAA CCA CGC CAG G 14105-14123
RdRP_SARSr Forward Primer GTG ARA TGG TCA TGT GTG GCG G erlaubt A15435G 3, 4
GTG AAA TGG TCA TGT GTG GCG G 15431-15452 original
Reverse Primer CAR ATG TTA AAS ACA CTA TTA GCA TA benötigt T15519C/T15519G; erlaubt T15528C
TAT GCT AAT AGT GTT TTT AAC ATT TG 15505-15530 original
TaqMan-Sonde P1 CAG GTG GAA CCT CAT CAG GAG ATG C 15470-15494
TaqMan-Sonde P2 CCA GGT GGW ACR TCA TCM GGT GAT GC benötigt C15480G/C15480A + A15489T; erlaubt A15477T A15486C
CCA GGT GGA ACC TCA TCA GGA GAT GC 15469-15494 original
RdRp/Hel Forward Primer CGC ATA CAG TCT TRC AGG CT erlaubt A16233G 4
CGC ATA CAG TCT TAC AGG CT 16220-16239 original
Reverse Primer GTG TGA TGT TGA WAT GAC ATG GTC benötigt T16353C; erlaubt A16341T
GAC CAT GTC ATA TCA ACA TCA CAT 16330-16353 original
TaqMan-Sonde TTA AGA TGT GGT GCT TGC ATA CGT AGA C 16276-16303
HKU-ORF1b-nsp14 Forward Primer TGG GGY TTT ACR GGT AAC CT erlaubt T18783C A18789G 3, 4
TGG GGT TTT ACA GGT AAC CT 18778-18797 original
Reverse Primer AAC RCG CTT AAC AAA GCA CTC erlaubt T18906C
GAG TGC TTT GTT AAG CGT GTT 18889-18909 original
TaqMan-Sonde TAG TTG TGA TGC WAT CAT GAC TAG erlaubt A18861T
TAG TTG TGA TGC AAT CAT GAC TAG 18849-18872 original
Yale 69/70del Forward Primer TCA ACT CAG GAC TTG TTC TTA CCT 21710-21733 5
Reverse Primer TGG TAG GAC AGG GTT ATC AAA C 21796-21817
Probe (drop-out) TTC CAT GCT ATA CAT GTC TCT GGG A 21755-21779
Probe (detection) TGG TTC CAT GCT ATC TCT GGG ACC A 21752-21782 reagiert auf 69/70 del
Yale 144del Forward Primer ACG CTA CTA ATG TTG TTA TTA AAG TCT 21927-21954 5
Reverse Primer TCT GAA CTC ACT TTC CAT CCA ACT 22013-22036
Probe (drop-out) TCC ATT TTT GGG TGT TTA TTA CCA CA 21976-22001
Probe (detection) TCC ATT TTT GGG TGT TTA CCA CA 21976-22001 reagiert auf 144 del
S Forward Primer CCT ACT AAA TTA AAT GAT CTC TGC TTT ACT 22712-22741 4
Reverse Primer CAA GCT ATA ACG CAG CCT GTA 22849-22869
TaqMan-Sonde CGC TCC AGG GCA AAC TGG AAA G 22792-22813 keine vollständige Übereinstimmung bei K417N (Südafrika) und K417T (Brasilien)
S-5 Forward Primer CAG GTA TAT GCG CTA GTT ATC AGA C 23565-23589 4
Reverse Primer CCA AGT GAC ATA GTG TAG GCA ATG 23638-23661
TaqMan-Sonde AGA CTA ATT CTC CTC GGC GGG CAC G 23592-23616 keine vollständige Übereinstimmung bei P681H (GB)
S-6 Forward Primer GCA GGT ATA TGC GCT AGT TAT CAG 23564-23587 4
Reverse Primer ACA CTG GTA GAA TTT CTG TGG TAA C benötigt G23734AT + G23747T
GTT ACC ACG AAA TTC TAC CAG TGT 23726-23750 original
TaqMan-Sonde AGA CTA ATT CTC CTC GGC GGG CAC G 23592-23616 keine vollständige Übereinstimmung bei P681H (GB)
E gene / E_Sarbeco Forward Primer ACA GGT ACG TTA ATA GTT AAT AGC GT 26269-26294 3, 4
Reverse Primer ATA TTG CAG CAG TAC GCA CAC A 26360-26381
TaqMan-Sonde ACA CTA GCC ATC CTT ACT GCG CTT CG 26332-26357
E Forwad Primer ACT TCT TTT TCT TGC TTT CGT GGT 26295-26318 4
Reverse Primer GCA GCA GTA CGC ACA CAA TC 26357-26376
TaqMan-Sonde CTA GTT ACA CTA GCC ATC CTT ACT GC 26326-26351
CDC N1 Forward Primer GAC CCC AAA ATC AGC GAA AT 28287-28306 3, 5
Reverse Primer TCT GGT TAC TGC CAG TTG AAT CTG 28335-28358
TaqMan-Sonde ACC CCG CAT TAC GTT TGG TGG ACC 28309-28332
WH-NIC N Forward Primer CGT TTG GTG GAC CCT CAG AT 28320-28339 3, 4
Reverse Primer CCC CAC TGC GTT CTC CAT T 28358-28376
TaqMan-Sonde CAA CTG GCA GTA ACC A 28341-28356
2019-nCoV_N3 Forward Primer GGG AGC CTT GAA TAC ACC AAA A 28681-28702 3, 4
Reverse Primer TGT AGC ACG ATT GCA GCA TTG 28732-28752
TaqMan-Sonde AYC ACA TTG GCA CCC GCA ATC CTG erlaubt T28705C
ATC ACA TTG GCA CCC GCA ATC CTG 28704-28727 original
N Forward Primer CAC ATT GGC ACC CGC AAT C 28706-28724 4
Reverse Primer GAG GAA CGA GAA GAG GCT TG 28814-28833
TaqMan-Sonde ACT TCC TCA AGG AAC AAC ATT GCC A 28753-28777
SARS-CoV-2 N Forward Primer GGG GAA CTT CTC CTG CTA GAA T 28881-28902 nicht geeignet für 20B 1, 4
Reverse Primer CAG ACA TTT TGC TCT CAA GCT G 28958-28979
TaqMan-Sonde TTG CTG CTG CTT GAC AGA TT 28934-28953
NIID_2019-nCOV_N Forward Primer AAA TTT TGG GGA CCA GGA AC 29125-29144 3, 4
Reverse Primer TGG CAG CTG TGT AGG TCA AC 29263-29282
TaqMan-Sonde ATG TCG CGC ATT GGC ATG GA 29222-29241
HKU-N Forward Primer TAA TCA GAC AAG GAA CTG ATT A 29145-29168 3, 4
Reverse Primer CGA AGG TGT GAC TTC CAT G 29236-29254
TaqMan-Sonde GCA AAT TGT GCA ATT TGC GG benötigt C29187T + A29188G + C29197G + C29198G
GCA AAT TGC ACA ATT TGC CC 29179-29198 original
2019-nCoV_N2 Forward Primer TTA CAA ACA TTG GCC GCA AA 29164-29183 3, 4
Reverse Primer GCG CGA CAT TCC GAA GAA 29213-29230
TaqMan-Sonde ACA ATT TGC CCC CAG CGC TTC AG 29188-29210
N Forward Primer GCG TTC TTC GGA ATG TCG 29210-29227 4
Reverse Primer TTG GAT CTT TGT CAT CCA ATT TG 29284-29306
TaqMan-Sonde AAC GTG GTT GAC CTA CAC AGS T erlaubt G29277C
AAC GTG GTT GAC CTA CAC AGG T 29257-29278 original


  1. www.mdpi.com
  2. www.protocols.io
  3. www.who.int
  4. www.sciensano.be
  5. virological.org


Wichtige Testkriterien: Hohe Sensitivität und Spezifität

Besonders aussagekräftig sind Tests, welche eine hohe Spezifität und eine hohe Sensitivität haben. Die Spezifität beschreibt die Genauigkeit des Tests, ob alle gesunden getesteten Personen auch als Gesunde erkannt werden. Die Sensitivität gibt Auskunft darüber, ob alle Kranken auch als Kranke erkannt werden.

Die Gesellschaft zur Förderung der Qualitätssicherung in medizinischen Laboratorien für PCR-Testungen ermittelte in 488 Laboren aus 36 Ländern die Mittelwerte: 98,2% für Spezifität und 99,3% für Sensitivität


Diese Erfindung ist nicht wirklich neu, aber noch nicht jedem bekannt. Ihr habt ja sicherlich schon oft gelesen dass die Positivrate aller Corona-Tests in der Nähe der Falschpositivrate liegt. Allerdings scheint hier ein Missverständnis vorzuliegen. Das Problem ist dass man oft nur die Fehlerquoten von PCR-Tests findet die nur auf ein Gen testen. Allerdings wurde schon vor Beginn der Corona-Pandemie viel getestet und die Experten die die Tests auswerten kennen sich bestens aus.

Bei einem Dual-Target-PCR werden mindestens 2 unabhängige Genregionen gleichzeitig nachgewiesen. Diese können zum Beispiel sein: E-Gen, N-Gen, Orf1-Gen, S-Gen. Dieses Verfahren erhöht die Sensitivität und Spezifität des SARS-CoV-2-Nachweises. Ein positives Ergebnis für mindestens 2 Gene weist mit sehr hoher Wahrscheinlichkeit auf eine CoV-2 Infektion hin.


  • Bei einer Spezifität von 98,2% werden 1,8% aller gesunden Menschen falsch-positiv getestet. Das heißt von 1.000.000 Individuen werden 18.000 positiv getestet obwohl sie eigentlich gesund sind. Suchen wir jedoch nach 2 verschieden Genen so haben wir 2 Gene mit jeweils 18.000 positiven Ergebnissen. Von den 18.000 des einen Gens werden 324 ebenfalls auf das andere Gen positiv getestet. Die Fehlerrate beträgt bei 2 unterschiedlichen Genen 324ppm oder 0,0324% was einer Spezifität von 99,9676% entspricht. Von etwa 3.000 gesunden wird einer positiv getestet.
  • Erhöhen wir die Anzahl der Gene auf 3 so haben wir bei 1.000.000 Tests 3 Gene die jeweils 18.000 mal positiv getestet werden. Darunter befinden sich 3 Teilmengen mit jeweils 324 positiven Ergebnissen mit jeweils 2 Fehlern die eine weitere Teilmenge beinhalten. Bei 5,832 von 1.000.000 Tests werden alle 3 Gene falsch positiv angezeigt. Die Fehlerquote beträgt bei 3 unterschiedlichen Genen 5,832ppm oder 0,0005832% was einer Spezifität von 99,9994168% entspricht. Von etwa 170.000 gesunden wird einer positiv getestet.

  • Bei einer Sensitivität von 99,3% werden 0,7% aller infizierten Menschen falsch-negativ getestet. Das heißt von 1.000.000 Individuen werden 7.000 negativ getestet obwohl sie eigentlich infiziert sind. Suchen wir jedoch nach 2 verschieden Genen so haben wir 2 Gene mit jeweils 7.000 negativen Ergebnissen. Von den 7.000 des einen Gens werden 49 ebenfalls auf das andere Gen negativ getestet. Die Fehlerrate beträgt bei 2 unterschiedlichen Genen 49ppm oder 0,0049% was einer Sensitivität von 99,9951% entspricht. Von etwa 20.000 Infizierten wird einer negativ getestet.
  • Erhöhen wir die Anzahl der Gene auf 3 so haben wir bei 1.000.000 Tests 3 Gene die jeweils 7.000 mal negativ getestet werden. Darunter befinden sich 3 Teilmengen mit jeweils 49 negativen Ergebnissen mit jeweils 2 Fehlern die eine weitere Teilmenge beinhalten. Bei 0,343 von 1.000.000 Infizierten werden alle 3 Gene falsch negativ angezeigt. Die Fehlerquote beträgt bei 3 unterschiedlichen Genen 343ppb oder 0,0000343% was einer Sensitivität von 99,9999657% entspricht. Von etwa 3 Millionen Infizierten wird einer negativ getestet.

Besonders wichtig ist eine hohe Sensitivität da ein gesunder Mensch in der Quarantäne keinen Schaden anrichtet aber ein negativ getesteter frei rum laufen darf.

Was bedeutet der ct-Wert?

Vereinfacht gesagt gibt der ct-Wert (englisch: cycle threshold) an, wie lange eine Probe im Labor untersucht werden muss, also wie viele Zyklen notwendig sind, bis es zu einem positiven Befund kommt, sprich wie viele "Runden" das Probenmaterial durchlaufen muss, bis das Ergbut von SARS-CoV-2 nachgewiesen werden kann. Ist Virusmaterial bereits nach einer kurzen Laufzeit nachweisbar spricht dies wahrscheinlich für eine hohe Viruslast und der ct-Wert ist gering. Ist der ct-Wert höher, beispielsweise 30, heißt dies vereinfacht gesagt, dass die Probe viele Runden durchlaufen musste, bis Virusmaterial gefunden wurde.

Bei ct-Werten über 30 lässt sich das Virus nach bisherigen Erkenntnissen schwieriger anzüchten, was für eine geringere Infektiosität dieser Patienten spricht. Der ct-Wert wird allerdings beispielsweise vom Ort der Probenentnahme, der Trasportzeit und dem verwendeten Testsystem beeinflusst, so dass er nur ein Hinweis sein kann und für sich alleine gesehen nicht aussagefähig ist.

Welche anderen Tests gibt es zum Nachweis von Corona?

Der Antigen-Test befindet sich noch in der Erprobung. Bei diesem Test wird nicht das Erbmaterial des Virus nachgewiesen, sondern Eiweißfragmente (Proteine) des Virus. Dieser Test ist schneller als ein PCR-Schnelltest. Der Antigen-Test wird höchstwahrscheinlich wie die Schnelltests nicht so zuverlässig sein wie ein Labortest. Das liegt unter anderem daran, dass sich die Coronaviren untereinander sehr ähnlich sind. Entsprechend kann es gelegentlich vorkommen, dass ein Test nicht wegen SARS-COV-2 positiv ist, sondern wegen eines anderen Coronavirus. Das macht zusätzliche Testungen notwendig.

Des weiteren gibt es auch noch Antikörpertests. Diese testen auf Antikörper. Sind diese Test positiv ist jedoch unklar ob man aktuell an Corona erkrankt ist oder ansteckend ist. Ein positives Ergebnis erscheint wenn man schon längere Zeit mit Corona infiziert ist oder nach einer Erkrankung.

Wer wird getestet?

Bitte den Link anklicken. Teststrategien können sich jederzeit ändern.



Häufige Irrtümer im Zusammenhang mit Corona

Portugiesisches Gericht hält PCR-Tests für unzuverlässig

Lissabon 11.11.2020
In dem Urteil wird behauptet dass PCR-Tests nicht zuverlässig seien.

Vier Deutsche reisten im August auf die Azoren und mussten mehrere Tage in Quarantäne, da eine der Personen positiv auf SARS-CoV-2 getestet wurde. Vor einem Regionalgericht klagten die Deutschen, da sie dies als Freiheitsentzug betrachteten. Die Quarantäne wurde aufgehoben da nur ein Arzt eine Person als krank oder gesundheitsgefährdend einstufen darf, nicht jedoch eine Gesundheitsbehörde. Desweiteren haben die Richterinnen behauptet der PCR-Tests sei nicht zuverlässig genug um zweifelsfrei eine Infektion mit SARS-COV-2 festzustellen. Die örtlichen Gesundheitsbehörden legten Berufung gegen das Urteil ein, doch auch das Berufungsgericht in Lissabon gab den Deutschen recht, die Gesundheitsbehörde hätte nicht über diesen Freiheitsentzug entscheiden dürfen. Zudem darf man ohne einen Rechtsbruch auch nicht festgehalten werden. Die Corona-Pandemie sei keine ausreichende Begründung, da damals noch nicht der Notstand galt, welcher Ausgangs- und Kontaktsperren beinhaltet. Die Äußerung über PCR-Tests in dem Berufungsurteil wurde allerdings von dem Obersten Justizrat Portugals kritisiert, da das Berufungsgericht seinerseits dessen Kompetenzen überschritt. So gelten PCR-Tests nach aktuellem Stand der Wissenschaft als sehr sicher. Die Richterinnen überschritten mit ihren Äußerungen zu den PCR-Tests ihre Kompetenzen – Richter dürfen sich in einem Urteil nur juristisch, eben ihrem Fachgebiet, äußern, nicht aber medizinische Allgemeinäußerungen einbringen, ohne über den aktuellen Stand der Wissenschaft und die exakten Messwerte des PCR-Tests an den Deutschen Bescheid zu wissen.

Quelle: Mimikama

allgemeine Irrtümer

Das Tragen einer Maske kann zum Tod führen.

Bisher ist weltweit kein einziger Fall bekannt, bei dem ein Mensch wegen einer Maske zu Tode kam. Das könnte daran liegen dass man eine Maske einfach abnehmen kann, wenn man bemerkt, dass sich Körper zu wenig Sauerstoff und zu viel Kohlendioxid befindet.

Kinder unter zwei Jahren haben noch keinen ausreichenden Schutzreflex und sollen keine Maske tragen. Auch Menschen, die sich ihre Maske bei Atemnot nicht eigenständig absetzen können, sollten keine Maske tragen.

Unter der Maske kann sich zwar CO2 ansammeln, aber die Menge ist so gering, dass das CO2 gut verdünnt wird und der Körper normalerweise ausreichend mit Sauerstoff versorgt wird.

Im Sommer macht Corona Pause.

Bei vielen Infektionskrankheiten, allen voran die Grippe, kommt es im Sommer zu deutlich weniger Ansteckungen, unter anderem weil die Menschen weniger Zeit im Haus verbringen und warme, feuchte Luft das Virus an der Ausbreitung hindert. Andererseits trifft Sars-CoV-2 auf eine Bevölkerung, in der noch niemand immun ist, so dass auch eine durch den Sommer gebremste Ausbreitung einen Großteil der Bewohner erfassen könnte. Der Rückgang, der in Deutschland zumindest bis Anfang Juli zu beobachten war, ist also wahrscheinlich vor allem den konsequenten Maßnahmen zur sozialen Distanzierung geschuldet, die es unbedingt weiter einzuhalten gilt.

Wer bestimmte Vitamine oder Nahrungsergänzungsmittel einnimmt, kann sich gegen Covid-19 schützen.

Das ist falsch. Dafür gibt es keine wissenschaftlichen Belege. Ein Vitaminmangel kann das Immunsystem schwächen und Krankheiten verursachen. Vitaminpräparate sollten nur eingenommen werden wenn ein Mangel besteht. Ein Überschuss an Vitamin D oder C kann beispielsweise zu Nierensteinen führen.

Wer Iboprofen nimmt, erkrankt schlimmer.

Das lässt sich nicht mit Sicherheit sagen.

Die Einnahme von Chlordioxid hilft gegen das Coronavirus.

Es ist zwar richtig dass die Chemikalie Viren inaktiviert. Chlordioxid ist aber ein industrielles Desinfektions- und Bleichmittel, das unsere Haut und Schleimhaut stark verätzen kann. Das Bundesinstitut für Risikobewertung warnt deshalb schont seit vielen Jahren vor der Einnahme.

Wer täglich Alkohol trinkt, schützt sich vor einer Infektion mit dem Coronavirus.

Das ist Unsinn. Wissenschaftliche Studien belegen, dass ein chronischer Alkoholkonsum das Immunsystem schwächt.

An Geldscheinen und Münzen kann man sich mit dem Coronavirus anstecken.

Viele Experten halten es für unwahrscheinlich, dass man sich beim Bezahlen ansteckt. Die Virenmenge an der Oberfläche reicht in den meisten Fällen nicht aus, um eine Infektion auszulösen, zumal man die Erreger mit den Händen in den Rachen transportieren müsste. Wer die empfohlene Handhygiene befolgt und sich oft und gründlich mit Seife die Hände wäscht, braucht Geldscheine und Münzen nicht fürchten.

Das Virus hält sich mehrere Tage lang auf Türklinken, Bahnsitzen und anderen Oberflächen. Auch gelieferte Pakete sollte man deshalb nur mit Handschuhen anfassen.

Die Behauptung ist übertrieben. Sars-CoV-2-Partikel überleben auf Pappe offenbar bis zu 24 Stunden. Auf Kunststoff und Edelstahl sind sie sogar zwei bis drei Tage nachweisbar. Die Virusmenge, die nach einer Verdunstung auf einer bestimmten Oberfläche zurückbleibt, reicht aus um eine Zellkultur anzustecken.

Wenn man zehn Sekunden die Luft anhalten kann ohne Beschwerden oder Husten, heißt das, man hat sich nicht angesteckt.

Dafür gibt es keine wissenschaftlichen Belege.

Auch wenn Covid-19 ohne Symptome verläuft, bleibt die Lunge langfristig geschädigt.

Grundsätzlich gilt offenbar: Je leichter der Verlauf, desto geringer ist das Risiko für Langzeitfolgen. Doch es gibt Ausnahmen: So haben Mediziner von der Universitätsklinik Innsbruck beispielsweise bei einigen Tauchsportlern, die eher mild an Covid-19 erkrankt waren, Lungenschädigungen festgestellt. Sie können ihren Sport darum wohl vorerst nicht mehr ausüben. Außerdem stellt sich immer mehr heraus, dass das Virus nicht nur die Lunge, sondern auch andere Organe langfristig schädigen kann. Wie häufig die körperliche Fitness von Covid-19-Genesenen dauerhaft beeinträchtigt ist, lässt sich derzeit nicht sagen.

Schon kurz nachdem Covid-19 überstanden ist, kann man sich erneut anstecken.

In welchem Maß und wie lange nach einer Infektion eine Immunität besteht, ist derzeit weitgehend unklar. Auch wodurch diese vermittelt wird. Die meisten Patienten scheinen nach einer Infektion recht verlässlich Antikörper zu bilden, die das Virus neutralisieren. Neuere Studien weisen aber darauf hin, dass diese schon bald nach einer Infektion im Blut nicht mehr nachweisbar sind – vor allem bei Menschen, die wenige oder gar keine Symptome hatten. Das muss aber nicht bedeuten, dass man sich schon bald darauf wieder anstecken kann. Denn Antikörper – vor allem jener Typ, auf den momentan hauptsächlich getestet wird – stellen nur eine Komponente unseres Immunsystems dar. Auch andere Moleküle und Zelltypen, zum Beispiel T-Zellen könnten eine wichtige Rolle spielen. Von anderen menschlichen Coronaviren ist bekannt, dass man sich nach ein paar Monaten erneut anstecken kann.

Das Virus schwebt mehrere Minuten lang in der Luft, bevor es sich irgendwo niederlässt.

Das ist nicht ganz korrekt. Während größere ausgehustete Tröpfchen nach wenigen Sekunden zu Boden sinken, schweben winzige Tröpfchen, so genannte Aerosole, sehr lange in der Luft. Darin enthaltene Viren bleiben, zumindest in Labortests, auch infektiös. Lange Zeit wurde eine Übertragung durch Aerosole ausgeschlossen, inzwischen wird ihnen aber immer mehr Bedeutung zugesprochen. »Der längere Aufenthalt in kleinen, schlecht oder nicht belüfteten Räumen kann die Wahrscheinlichkeit einer Übertragung durch Aerosole auch über eine größere Distanz als zwei Meter erhöhen«, warnt das RKI auf seiner Homepage.

Ein Mund-Nasen-Schutz bringt nichts.

Masken helfen andere Menschen vor Tröpfchen und Partikeln zu schützen, die man beim Sprechen, Husten oder Niesen ausstößt. Wichtig ist unter anderem dass die Nase bedeckt ist.

Auch Hunde und Katzen können mit dem Coronavirus infiziert sein. Darum sollte man sie besser nicht mehr streicheln.

Stimmt nicht. Zwar ist inzwischen bekannt, dass sich einige Tierarten mit dem Virus anstecken können, darunter Haustiere wie Katzen und Hamster. Dass die Tiere dem Virus als Rückzugsort dienen und von ihnen aus auf Menschen überspringen, halten Fachleute aber für eher unwahrscheinlich. Aus Sicht des Friedrich-Loeffler-Instituts muss der Kontakt gesunder Personen zu Haustieren nach den derzeitig verfügbaren Informationen nicht eingeschränkt werden. Es sei aber immer ratsam, grundlegende Hygieneprinzien wie Händewaschen nach Kontakt einzuhalten.

Man braucht Desinfektionsmittel, um das Virus zu zerstören.

Nicht unbedingt. Auch handelsübliche Seife macht die Viren kaputt, weil sie Tenside enthält. Diese Molekülen haben sowohl einen Wasser als auch einen Fett liebenden Teil. Mit Letzterem greifen die Tenside die empfindliche Lipidhülle der Viren an. Die Wasser liebende Seite des Moleküls wendet sich dem Wasser zu, die wir beim Waschen über unsere Hände laufen lassen. Es entstehen kugelförmige Fetttröpfchen – die Mizellen –, die sich leicht wegwaschen lassen. Wie Fett in einer Pfanne mit Spülmittel.

Das Virus kann auch über das Trink- und Abwasser übertragen werden: Darum sollte man lieber kein Leitungswasser mehr trinken.

Trinkwasser, das nach den allgemein anerkannten Regeln der Technik gewonnen, aufbereitet und verteilt werde, sei sehr gut gegen Viren geschützt, heißt es auf den Seiten des Umweltbundesamts. Einschließlich Coronaviren. Die Experten halten es nach derzeitigem Kenntnisstand für höchst unwahrscheinlich, dass sich Sars-CoV-2 über die öffentliche Trinkwasserversorgung verbreitet.

Man kann sich beim Schwimmen mit dem Coronavirus infizieren.

Zumindest theoretisch wäre das möglich. Studien belegen, dass Coronaviren widerstandsfähig genug sind, um in Wasser für einige Tage nachweisbar zu bleiben. Laut dem Umweltbundesamt ist ein direkte Übertragung von Sars-CoV-2 über das Schwimm- und Badewasser aber höchst unwahrscheinlich, zumal das Virus hier sehr stark verdünnt vorliegt und dem Wasser meistens Chlor zur Desinfektion zugesetzt wird. Ein höheres Infektionsrisiko geht davon aus, dass sich hier sehr viele Menschen versammeln und oft wenig Abstand zueinander haben.

Auch Stechmücken können das Virus übertragen.

Das ist falsch. Das Virus verbreitet sich hauptsächlich über Tröpfchen und gehört zu einer völlig anderen Familie als jene, die von Insekten übertragen werden. Mit dem Stich einer Mücke könne das Virus nach dem derzeitigen Kenntnisstand nicht in den Körper gelangen, sagte Mücken-Expertin Doreen Werner vom Leibniz-Zentrum für Agrarlandschaftsforschung gegenüber der Deutschen Presseagentur.

Rauchen oder Dampfen verschlimmert die Covid-19-Erkrankung.

Covid-19 ist noch zu neu, als dass es dazu aussagekräftige Studien gäbe.

Das Coronavirus ist mutiert. Der L-Typ ist besonders aggressiv und verbreitet sich schnell.

Korrekt ist, dass es zwei Typen gibt, S und L genannt. Auch stimmt, dass sie sich durch eine Mutation unterscheiden. Doch Mutationen verändern nicht automatisch die Eigenschaften eines Virus. Insofern ist unklar, ob der L-Typ, nur weil er weiter verbreitet ist, tatsächlich aggressiver ist als der S-Typ. Ebenso ob er sich schneller verbreitet. »Einer dieser Zweige kann rein zufällig größer sein als der andere«, sagt beispielsweise der Evolutionsbiologe Andrew Rambaut von der University of Edinburgh.

Der Krankheitserreger Sars-CoV-2 ist schon lange bekannt.

Sars-CoV-2 ist ein neues Virus, das zu der Familie der Coronaviren gehört. Die Familie der Coronaviren ist seit Mitte der 1960er Jahre bekannt.

Forscher haben Sars-CoV-2 künstlich im Labor geschaffen.

Das ist ein Mythos. Erbgutanalysen zeigen: Das Virus Sars-CoV-2 ist über natürliche Mutation und Selektion entstanden, wie unabhängige Forscher in der Fachzeitschrift »Nature« berichten.

Kein Virus, sondern das 5G-Netz hat die Pandemie ausgelöst.

Rasch verbreitet hat sich das Gerücht, 5G-Wellen würden zu grippeähnlichen Symptomen und einem Zellabbau führend. Auf Grund seiner vollständigen 5G-Abdeckung sei die Gegend um Wuhan darum besonders stark betroffen, geht der Mythos weiter. Das Bundesamt für Strahlenschutz widerlegt dies: In einer E-Mail an das Recherchezentrum CORRECTIV schreibt es: »5G verursacht weder Zellabbau noch grippeähnliche Symptome. 5G kann (wie alle Felder von Mobilfunksendeanlagen, also auch 2G, 3G, 4G) höchstens eine geringfügige, nicht wahrnehmbare Erwärmung verursachen, die sich vor allem auf die Körperoberfläche beschränkt.« 

Quelle: spektrum.de (teilweise gekürzt)


Der RNA-Code des Coronavirus SARS-CoV-2 hat eine Länge von 29.903 Nukleotiden. Der Code beginnt mit einem nichttranslatierten Bereich mit der Bezeichnung 5'UTR und endet mit dem nichttranslatierten Bereich 3'UTR. Die Zahlen 3 und 5 beziehen sich auf die Nummer des Kohlenstoffatoms innerhalb der Pentose (5-fach-Zucker) in diesem Fall Ribose da es sich um RNA handelt. Ein Nukleosid besteht aus einer Pentose und einer Nukleobase. Ein Nukleotid hat am 5'-Ende einen Phosphatrest. Dieser Phosphatrest verbindet sich dann mit dem 3'-Ende der RNA. In RNA gibt es die 4 Nukleinbasen Adenin, Cytosin, Guanin und Uracil. Bestandteil von 3'UTR ist ein Poly(A)-Schwanz dieser ist eine Kette aus Adenin-Nukleotiden.

Die Abkürzung ORF steht für offener Leserahmen. Ein offener Leserahmen beginnt mit einem Start-Codon und endet mit einem Stop-Codon. 3 Nukleobasen werden jeweils zu 1 Codon zusammengefasst. Das Start-Codon entspricht der Aminosäure Methionin die Stop-Codons entsprechen keiner Aminosäure. Aus mehreren Aminosäuren entstehen Proteine. Aus dem RNA-Code können 20 verschiedene Aminosäuren übersetzt werden. Bis auf wenigen Ausnahmen werden den Aminosäuren mehrere Codes zugewiesen.

Die Abkürzung nsp steht für Nichtstrukturprotein. Diese werden innerhalb der Virionen nicht dringend benötigt und fehlen auch manchmal weil ja der Bauplan in der RNA vorhanden ist. Es kann also vorkommen dass man in der menschlichen Zelle etwas findet was in den Virionen fehlt.

Aufgund der Länge der RNA sind 3 Fehler pro Kopie nicht ungewöhnlich. Diese Fehler werden jedoch meistens erfolgreich korrigiert.

Position Bezeichnung Nukleotide Aminosäuren
1..265 5´UTR 265nt
266..13483 ORF1a polyprotein 13218nt 4405aa
266..13468,13468..21555 ORF1ab polyprotein 21290nt (+1) 7096aa
266..805 leader protein (nsp1) 540nt 180aa
806..2719 nsp2 1914nt 638aa
2720..8554 nsp3 5835nt 1945aa
8555..10054 nsp4 1500nt 500aa
10055..10972 3C-like proteinase (nsp5) 918nt 306aa
10973..11842 nsp6 870nt 290aa
11843..12091 nsp7 249nt 83aa
12092..12685 nsp8 594nt 198aa
12686..13024 nsp9 339nt 113aa
13025..13441 nsp10 417nt 139aa
13442..13480 nsp11 39nt 13aa
13442..13468,13468..16236 RNA-dependent RNA polymerase (nsp12) 2795nt (+1) 932aa
16237..18039 helicase (nsp13) 1803nt 601aa
18040..19620 3´-to-5´ exonuclease (nsp14) 1581nt 527aa
19621..20658 endoRNAse (nsp15) 1038nt 346aa
20659..21552 2´-O-ribose methyltransferase (nsp16) 894nt 298aa
21563..25384 surface glycoprotein 3822nt 1273aa
22517..23185 (S: 319..541) Rezeptor-Bindungsdomäne 669nt 223aa
25393..26220 ORF3a 828nt 275aa
26245..26472 envelope protein 228nt 75aa
26523..27191 membrane glycoprotein 669nt 222aa
27202..27387 ORF6 186nt 61aa
27394..27759 ORF7a 366nt 121aa
27756..27887 ORF7b 132nt 43aa
27894..28259 ORF8 366nt 121aa
28274..29533 nucleocapsid phosphoprotein 1260nt 419aa
29558..29674 ORF10 117nt 38aa
29675..29903 3´UTR 229nt
29871..29903 Poly(A)-Schwanz 33nt

Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome vollständige Gensequenz mit allen Proteinsequenzen und im Anschluss die vollständige Nukleotidsequenz. Anstelle des u wird hier ein t verwendet. Beides führt zur selben Übersetzung jedoch kommt t in DNA vor und u in RNA. Es gibt nur 2 Unterschiede und zwar t hat einen Methyl-rest den u nicht hat und es wird ein anderer Zucker verwendet.

Proteinlängen einiger Coronaviren in Anzahl der Aminosäuren

Corona SARS MERS OC43 HKU1 PrC31 RaTG13
ORF1ab 7.096 7.073 7.078 7.095 7.182 7.095 7.095
ORF1a 4.405 4.382 4.391 4.383 4.471
nsp1 180 180 193 246 222 180 180
nsp2 638 638 660 605 587 638 638
nsp3 1.945 1.922 1.887 1.899 2.029 1.944 1.944
nsp4 500 500 507 496 496 500 500
nsp5 306 306 306 303 303 306 306
nsp6 290 290 292 287 287 290 290
nsp7 83 83 83 89 92 83 83
nsp8 198 198 199 197 194 198 198
nsp9 113 113 110 110 110 113 113
nsp10 139 139 140 137 137 139 139
nsp11 13 13 14 14 14
nsp12 932 10 933 928 928 932 932
nsp13 601 601 598 603 603 601 601
nsp14 527 527 524 521 521 527 527
nsp15 346 346 343 375 374 346 346
nsp16 298 298 303 299 299 298 298
ns2 --- --- --- 278 --- --- ---
HE --- --- --- 424 386 --- ---
S 1.273 1.255 1.353 1.353 1.356 1.246 1.269
ORF3 --- --- 103 --- --- --- ---
ORF3a 275 274 --- --- --- 275 275
ORF3b --- 154 --- --- --- --- ---
--- --- 109 (ORF4a) 109 (ORF5) 109 (ORF4) --- ---
ORF4b --- --- 246 --- --- --- ---
ORF5 --- --- 224 --- --- --- ---
E 75 76 82 84 82 75 75
M 222 221 219 230 223 222 221
ORF6 61 63 --- --- --- 61 61
ORF7a 121 122 --- --- --- 122 121
ORF7b 43 44 --- --- --- 43 43
ORF8 121 --- --- --- --- 121 121
ORF8a --- 39 --- --- --- --- ---
ORF8b --- 84 --- --- --- --- ---
N2 --- --- --- --- 205 --- ---
N 419 422 413 448 441 419 419
ORF9a --- 70 --- --- --- --- ---
ORF9b --- 98 --- --- --- --- ---
andere 38 (ORF10) --- 112 (ORF8b) 60 (I protein) --- 38 (ORF10) ---

weitere Details zu ausgewählten Viren

Virus GenBank C G T A CpG Länge nt
Corona NC_045512.2 5.492 (18,37%) 5.863 (19,61%) 9.594 (32,08%) 8.954 (29,94%) 0,41 29.903
BANAL-20-52 MZ937000.1 5.492 (18,41%) 5.837 (19,56%) 9.571 (32,08%) 8.938 (29,96%) 0,40 29.838
RaTG13 MN996532.2 5.507 (18,45%) 5.847 (19,59%) 9.579 (32,09%) 8.922 (29,88%) 0,41 29.855
RacCS203 MW251308.1 5.513 (18,48%) 5.883 (19,72%) 9.512 (31,89%) 8.867 (29,72%) 0,43 29.832
MP789 MT121216.1 5.481 (18,57%) 5.794 (19,63%) 9.378 (31,77%) 8.868 (30,04%) 0,39 29.521
GX-P5L MT040335.1 5.600 (18,79%) 5.877 (19,72%) 9.429 (31,64%) 8.900 (29,86%) 0,42 29.806
PrC31 MW703458.1 5.596 (18,80%) 5.948 (19,98%) 9.431 (31,69%) 8.785 (29,52%) 0,44 29.765
BM48-31 GU190215.1 5.691 (19,44%) 6.151 (21,01%) 9.304 (31,78%) 8.130 (27,77%) 0,51 29.276
Rc-o319 LC556375.1 5.818 (19,58%) 6.135 (20,64%) 8.983 (30,23%) 8.782 (29,55%) 0,44 29.718
SARS Tor2 NC_004718.3 5.940 (19,97%) 6.187 (20,80%) 9.143 (30,73%) 8.481 (28,51%) 0,46 29.751
HKU3-1 DQ022305.2 5.942 (19,99%) 6.282 (21,13%) 9.057 (30,47%) 8.447 (28,41%) 0,50 29.728
WIV16 KT444582.1 6.078 (20,07%) 6.311 (20,84%) 9.283 (30,65%) 8.618 (28,45%) 0,47 30.290



Punktmutationen sind Mutationen bei der eine Base gegen eine andere Base ersetzt wird. Man unterscheidet zwischen Transition und Transversion. Bei einer Transition wird entweder eine Purinbase gegen eine ander Purinbase oder eine Pyrimidinbase gegen eine andere Pyrimidinbase ausgetauscht. Adenin und Guanin sind Purinbasen. Cytosin, Uracil und Thymin sind Pyrimidinbasen. Bei einer Transversion wird eine Purinbase gegen eine Pyrimidinbase ersetzt oder anders herum. Transitionen sind häufiger als Transversionen. Am häufigsten wird Cytosin in Thymin verwandelt. Mutationen von c nach t sind häufiger als von t nach c, ebenfalls sind Mutationen von a nach g häufiger als von g nach a. Das liegt an Methylierung und anschließender Desaminierung.

Mutationsverhalten vom Helicase-Protein (nsp13)

Das Helicase-Protein verhält sich wie vermutlich andere Proteine auch ein wenig auffällig. Es kann vollgestopft sein mit synonymen Mutationen. Das heißt der Code verändert sich aber das Ergebnis bleibt das Selbe.

Vergleich unterschiedlicher Helicaseproteine

Dieses Bild zeigt einen aus Aminosäuren abgeleiteten Stammbaum vom Helicase-Protein (nsp13).

Die nachfolgende Tabelle behandelt ausschließlich die Verbindungslinien im oben abgebildeten Stammbaum. Die Linie unten rechts die zu RacCS203 führt wurde weggelassen weil nur ein einzelnes Codon verändert wurde.

Virus A Virus B ct tc ag ga at ta gt tg ac ca cg gc Transitionen Transversionen Transitionen/ Transversionen Nukleotid-Mutationen Aminosäuren-Mutationen
Corona RaTG13 11 11 5 2 1 2 1 1 0 0 0 0 29 5 5,8:1 34 A505T
Corona RacCS224... 12 16 2 4 2 1 0 1 0 1 0 0 34 5 6,8:1 39 A598V
Corona RpYN06 11 20 2 4 2 2 0 2 0 1 0 0 37 7 5,29:1 44 I399V
Corona RmYN02 13 20 2 3 3 1 0 1 0 1 0 0 38 6 6,33:1 44 E591V
MP789 Corona 38 26 19 14 15 11 7 3 2 2 0 2 97 42 2,31:1 139 E466D
Corona SARS Tor2 28 59 22 17 29 22 2 10 8 6 1 5 126 83 1,52:1 209 V570I
SARS Tor2 PrC31 29 15 9 10 2 2 0 0 0 0 0 0 63 4 15,75:1 67 A117V, P172S
YN2018C SARS Tor2 17 17 6 8 0 1 1 2 1 1 0 1 48 7 6,86:1 55 E466D
WIV16 YN2018C 16 17 7 6 1 0 2 2 0 1 0 0 46 6 7,67:1 52 V592I
YN2018C MP789 53 30 15 28 23 31 5 6 6 7 5 3 126 86 1,47:1 212 I570V
YN2018C Rs806/2006 1.Hälfte 5 7 4 5 0 1 0 0 0 0 0 0 21 1 21:1 22 E261G
YN2018C Rs806/2006 2.Hälfte 22 23 14 17 8 14 4 1 4 0 0 0 55 31 1,77:1 86 -
WIV16 HKU3-1 37 26 22 17 16 27 4 4 4 3 0 2 102 60 1,70:1 162 H166Y, D260N, V272I, F475Y

Die nachfolgende Tabelle behandelt mehr oder weniger willkürliche Vergleiche. Die nachfolgende Tabelle berücksichtigt keine Deletionen.

Virus A Virus B ct tc ag ga at ta gt tg ac ca cg gc Transitionen Transversionen Transitionen/ Transversionen Nukleotid-Mutationen Aminosäuren-Mutationen
P4L MP789 41 48 31 23 32 37 11 11 11 7 1 3 143 113 1,27:1 256 11
P4L Corona 47 45 36 24 37 38 10 5 12 8 1 3 152 114 1,33:1 266 10
P4L RaTG13 44 45 35 24 42 37 3 1 8 11 7 10 148 119 1,25:1 267 9
P4L SARS Tor2 35 64 37 25 46 40 8 11 17 7 4 6 161 139 1,16:1 300 9
MP789 BtKY72 50 50 50 24 41 31 6 13 13 12 7 6 174 129 1,35:1 303 17
BM48-31 BtKY72 66 42 44 40 23 33 10 7 6 4 1 1 192 85 2,26:1 277 13
AABSMF BtKY72 60 48 40 30 26 34 8 13 11 11 2 2 178 107 1,66:1 285 12
Khosta-1 BM48-31 19 27 14 6 1 4 2 0 0 0 1 1 66 9 7,33:1 75 5
Khosta-1 Khosta-2 67 45 41 37 30 35 10 10 6 8 3 5 190 107 1,78:1 297 22
WIV16 SC2018 22 20 11 5 3 1 0 1 0 1 1 0 58 7 8,29:1 65 3
BtCoV/279/2005 WIV16 44 37 12 20 22 18 4 2 3 1 2 1 113 53 2,13:1 166 1
OC43 HKU1 50 37 29 52 50 38 28 9 6 27 2 4 168 164 1,02:1 332 63
RhGB01 Khosta-2 46 37 15 35 4 8 3 5 1 1 0 0 133 22 6,05:1 155 18
Khosta-1 Corona 63 41 16 34 32 41 17 8 8 12 3 5 154 126 1,22:1 280 8
WIV16 LYRa11 32 18 13 9 4 5 1 4 1 1 0 0 72 16 4,5:1 88 3
civet007 YN2018C 17 17 8 6 1 0 2 0 0 1 1 0 48 5 9,6:1 53 0
Corona BANAL-20-52 12 25 4 2 3 2 0 2 0 1 0 0 43 8 5,375:1 51 0
RacCS203 BANAL-20-52 14 23 7 4 2 2 0 2 1 1 0 0 48 8 6:1 56 2
RaTG13 BANAL-20-52 9 20 4 4 3 3 0 2 0 1 0 0 37 9 4,11:1 46 1
Corona BANAL-20-103 12 24 4 2 2 3 1 2 1 1 0 0 42 10 4,2:1 52 1
Corona BANAL-20-116 6 13 4 2 1 1 0 1 0 2 0 0 25 5 5:1 30 0
BANAL-20-103 BANAL-20-116 17 16 6 5 3 2 1 1 0 2 0 0 44 9 4,89:1 53 1
FCoV "Black" FCoV "Felix" 18 15 8 4 1 0 2 0 4 0 0 0 45 7 6,43:1 52 6
TCoV/VA-74/03 ph/China/I0710/17 39 36 31 24 19 13 7 5 4 9 2 6 130 65 2,00:1 195 22
TCoV/IN-517/94 TCoV/VA-74/03 8 15 9 11 5 5 3 2 0 2 0 1 43 18 2,39:1 61 5
Hedgehog coronavirus 1 HKU31 strain Rs13 29 51 42 31 27 26 7 11 7 7 2 2 153 89 1,72:1 242 22

Die nachfolgende Tabelle enthält die Viren die oben verglichen werden.

Name GenBank Wirt Fundort Datum
Corona NC_045512.2 Homo sapiens China Dezember 2019
MP789 MT121216.1 Manis javanica China: Guangdong 29.03.2019
RaTG13 MN996532.2 Rhinolophus affinis China: Tongguan 24.07.2013
RacCS203 MW251308.1 Rhinolophus acuminatus Thailand 19.06.2020
RacCS253 MW251310.1 Rhinolophus acuminatus Thailand 19.06.2020
RmYN02 MW201981.1 Rhinolophus malayanus China: Yunnan 25.06.2019
SARS NC_004718.3 Homo sapiens; patient #2 Canada: Toronto 13.04.2003 (submitted)
PrC31 MW703458.1 Rhinolophus blythi China August 2018
Rs806/2006 FJ588687.1 Rhinolophus sinicus China 2006
HKU3-1 DQ022305.2 horseshoe bats China 2005
WIV16 KT444582.1 Rhinolophus sinicus China 21-Jul-2013 (Sonntag)
RpYN06 MZ081381.1 Rhinolophus pusillus China 25.05.2020
YN2018C MK211377.1 Rhinolophus affinis China September 2016
PCoV_GX-P4L MT040333.1 Manis javanica China 2017
BM48-31 NC_014470.1 Rhinolophus blasii Bulgaria 2008
AABSMF MT726045.1 Rhinolophus sp. (bat) Rwanda 27.09.2011
BtKY72 KY352407.1 Rhinolophus sp. (bat) Kenya August 2007
Khosta-1 MZ190137.1 Rhinolophus ferrumequinum Russland: Sotschi 2020
Khosta-2 MZ190138.1 Rhinolophus hipposideros Russland: Sotschi 2020
SC2018 MK211374.1 Rhinolophus sp. China August 2016
BtCoV/279/2005 DQ648857.1 Fledermaus China 2005?
OC43 NC_006213 Homo sapiens USA ca. 2004
HKU1 NC_006577 Homo sapiens patient with pneumonia ca. 2004
RhGB01 MW719567.1 Rhinolophus hipposideros United Kingdom 18.09.2020
LYRa11 KF569996.1 Rhinolophus affinis China 2011
civet007 AY572034.1 civet China 2004
civet020 AY572038.1 civet China 2004
BANAL-20-52 MZ937000.1 Rhinolophus malayanus Laos 05.07.2020
BANAL-20-103 MZ937001.1 Rhinolophus pusillus Laos 07.07.2020
BANAL-20-116 MZ937002.1 Rhinolophus malayanus Laos 07.07.2020
FCoV "Black" EU186072.1 Katze USA 1970er
FCoV "Felix" MG893511.1 Katze Deutschland Juli 2012
TCoV/IN-517/94 GQ427175.1 Truthahn USA 1994
TCoV/VA-74/03 GQ427173.1 Truthahn USA 2003
gammaCoV/ph/China/I0710/17 MK423876.1 Fasan China 2017
Hedgehog coronavirus 1 MK679660.1 Braunbrustigel UK 2014
hedgehog HKU31 strain Rs13 MK907287.1 Chinesischer Igel China 2014

Bei dem Vergleich der Helikaseproteine von civet007 und civet020 findet man eine Transition die eine nichtsynonyme Mutation verursacht. Wenn man civet007 mit SARS Tor2 vergleicht findet man eine Transversion die für eine nichtsynonyme Mutation verantwortlich ist.

abschließende Worte

Auffällig ist das sehr unterschiedliche Verhältnis zwischen Transitionen und Transversionen. Da nahe Verwandte meistens ein hohes Verhältnis haben kann man wohl davon ausgehen dass hohe Werte den Fledermäusen zuzuordnen sind. Die entferntesten Verwandten, denen ich eine Ansteckung von Fledermaus zu Fledermaus zutraue, sind derzeit RhGB01 und Khosta-2. Die Fundorte der beiden Viren liegen etwas mehr als 3.000 Kilometer auseinander. Ein möglicher gemeinsamer Vorfahre könnte vor etwa 40 Jahren gelebt haben.

Sollte das Verhältnis zwischen Transitionen uns Transversionen deutlich unterhalb von 6:1 liegen kann es daran liegen, dass die Gesamtzahl niedrig ist und schon geringfügige Abweichungen eine große Auswirkung auf das Ergebnis hat. Allgemein würde ich jedoch sagen je niedriger das Verhältnis desto Wahrscheinlicher ist es dass der gemeinsame Vorfahre nicht in einer Fledermaus gelebt hat.

Bei sehr weit entfernten Verwandten, die weniger als 80% Ähnlichkeit in den Nukleotiden haben, ist das Verhältnis zwischen Transitionen und Transversionen möglicherweise weniger aussagekräftig, weil Nukleotide mehr als einmal sich verändern können. 6 Transitionen und 1 Transversion sehen wie eine Transversion aus wenn immer wieder das selbe Nukleotid von den Veränderungen betroffen ist.


Dinukleotide sind 2 aufeinander folgende Nukleotide. Bei der Namensgebung wird das verbindende Phosphat mit angegeben um Verwechslungen zu vermeiden. Man darf das p auch weglassen. Allerdings werden die Bezeichnungen CG und AT auch für zwei gegenüberliegende Nukleotide in DNA- und doppelsträngigen RNA-Strängen verwendet. Um die Häufigkeit von Dinukleotiden zu errechnen multipliziert man die Häufigkeiten (n%/100%) der beiden Einzelnukleotide, hierdurch erhält man einen Wert der einer relativen Häufigkeit in Höhe von 1 entspricht. Durch Methylierung und anschließender Mutation und auf andere Weise auftretende Mutationen verändert sich das Verhältnis der Dinukleotide da unter anderem CpG sehr häufig mutiert. Betrachtet man die relative Häufigkeit der Dinukleotide fällt auf dass Corona kein durchschnittliches Coronavirus ist. Corona und seine nächsten Verwandten haben extrem niedrige CpG-Werte im Vergleich zu anderen Coronaviren. Aber auch andere Dinucleotide stellen neue Grenzwerte für die Coronaviren bereit.

Dinukleotide in den Helicase-Proteinen
Virus ApA ApC ApG ApU CpA CpC CpG CpU GpA GpC GpG GpU UpA UpC UpG UpU
Corona 165 129 101 151 140 49 24 121 92 81 53 124 149 75 174 172
MP789 168 135 108 143 136 45 34 128 98 85 47 120 151 80 161 158
RaTG13 160 133 104 146 138 46 27 126 96 80 52 125 149 77 171 171
RacCS253 163 134 100 150 137 51 27 123 94 78 54 124 152 77 169 167
RmYN02 164 131 102 149 141 52 24 124 92 80 52 126 149 80 171 164
relative Häufigkeit
Corona 0,998 1,275 0,953 0,875 1,384 0,792 0,370 1,146 0,868 1,249 0,780 1,121 0,863 0,710 1,573 0,955
MP789 0,987 1,281 1,004 0,846 1,290 0,690 0,511 1,223 0,911 1,277 0,692 1,124 0,894 0,765 1,508 0,942
RaTG13 0,978 1,310 0,978 0,853 1,360 0,730 0,409 1,187 0,903 1,213 0,752 1,124 0,871 0,725 1,538 0,956
RacCS253 0,982 1,307 0,942 0,875 1,336 0,805 0,412 1,161 0,885 1,189 0,795 1,131 0,887 0,727 1,541 0,943
RmYN02 0,992 1,269 0,962 0,872 1,365 0,806 0,363 1,162 0,868 1,209 0,765 1,151 0,872 0,750 1,562 0,930

Da hier nur 1803 Nukleotide ausgewertet wurden passen die Zahlen häufig nicht zum Gesamtgenom. Die relative Häufigkeit von CpG im Gesamtgenom beträgt bei Corona 0,41, RaTG13 0,41, MP789 0,39, SARS 0,46, PrC31 0,44, WIV16 0,47, OC43 0,48, MERS 0,56.


Detaillierter Vergleich zwischen den Helikase-Proteinen von SARS Tor2 und BatCoV Rs806/2006.

Position Transitionen Transversionen
1..60 4 0
61..120 3 0
121..180 2 0
181..240 4 0
241..300 4 0
301..360 0 0
361..420 3 0
421..480 3 0
481..540 3 0
541..600 0 0
601..660 4 0
661..720 0 0
721..780 2 0
781..840 3 0
841..900 2 0
1..900 37 0
901..960 2 3
961..1020 6 0
1021..1080 1 1
1081..1140 4 6
1141..1200 2 0
1201..1260 2 5
1261..1320 3 2
1321..1380 4 1
1381..1440 3 2
1441..1500 2 2
1501..1560 5 2
1561..1620 3 5
1621..1680 4 2
1681..1740 4 0
1741..1803 4 2
901..1803 49 33
1..1803 86 33

Hin und wieder kommt es vor dass Viren mehr als ein Elternteil haben. Das ist hier offensichtlich passiert. Man kann hier jetzt noch nicht eindeutig sagen welcher der Hybrid ist, es kann auch ein anderes Virus aus dem selben Stammbaum ein Hybrid sein. Zu erkennen ist es daran dass sich in der Mitte des Gencodes das Mutationsverhalten ändert. Während die untere Hälfte noch ziemlich natürlich wirkt, verhält sich die obere Hälfte eher unnatürlich. Es ist zwar eigentlich kein Problem dass in einer Hälfte des Codes die Transversionen fehlen, aber ich erwarte dann das Selbe von den Transitionen oder zumindest, dass ich diese mit den Fingern einer Hand zählen kann. Der Vergleich zweier Viren derselben Krankheit aber unterschiedlichen Jahrgangs hat ergeben dass es in Fledermäusen tatsächlich vorkommen kann, dass man in einem Coronavirus 42 aufeinanderfolgende Transitionen findet.

Mutationsverhalten von Coronaviren in Fledermäusen

Um das Mutationsverhalten von Coronaviren in von Fledermäusen besser zu verstehen, habe ich 2 Viren miteinander verglichen, die der selben Krankheit angehören und in einem Abstand von etwa einem Jahr und 8 Monaten gesammelt wurden. Ich habe die ältere Variante als Referenzsequenz auserwählt.

Genbank Name Fundort Datum Länge (nt)
MT726045.1 PREDICT/PRD-0038/AABSMF Ruanda 27.09.2011 29246
MT726044.1 PREDICT/PDF-2370/OTBA35RSV Uganda 30.05.2013 29243

Protein Länge aa Länge nt Mutationen aa Mutationen nt Ähnlichkeit aa Ähnlichkeit nt
nsp1 180 540 1 1 99,44 99,81
nsp2 638 1914 8 40 98,75 97,91
nsp3 1898 5694 16 54 99,16 99,05
nsp4 500 1500 1 5 99,80 99,67
nsp5 306 918 0 3 100 99,67
nsp6 290 870 1 5 99,66 99,43
nsp7 83 249 0 1 100 99,60
nsp8 198 594 0 3 100 99,44
nsp9 113 339 0 0 100 100
nsp10 139 417 0 1 100 99,76
nsp12 932 2795 0 3 100 99,89
nsp13 601 1803 0 8 100 99,56
nsp14 527 1581 1 18 99,81 98,86
nsp15 346 1038 2 15 99,42 98,55
nsp16 298 894 0 15 100 98,32
ORF1ab 7049 21149 30 172 99,86 99,19
Spike 1256* 3768* 7 99,44
ORF3 270 810 0 100
E 76 228 0 100
M 221 663 0 100
ORF6 64 192 0 100
ORF7a 118 354 1 99,15
ORF7b 43 129 1 97,67
N 414 1442 8 98,07
Summe 9511* 29246* 47 99,51
  • In der Variante aus Uganda fehlt eine Amminosäure im Spikeprotein das entspricht 3 Nukleotiden. In der Tabelle stehen die Werte die für die Variante aus Ruanda gelten.

Mutationen in ORF1ab

Nachfolgende Mutationen befinden sich im Polyprotein ORF1ab

c825t, t1281c, c1313t, t1319c, c1320t, g1359c, c1404t, c1446t, t1494c, c1620t, c1710t, t1763c, t1774g, t1782c, a1799g, a1881t, c1899t, t1932c, t1961c, t1968c, t2002c, c2034t, c2036t, a2129g, a2136g, t2139a, c2208t, t2268c, g2349t, g2361a, c2388t, a2391t, g2403a, c2412t, t2458c, g2463a, a2490c, a2535g, a2607g, t2610g, a2916g, g3057t, t3069g, g3228a, g3333a, c3349t, t3675g, c3708t, t3714g, a3725g, c3791a, a3823g, t3925c, g3939a, c3999t, g4003a, c4260t, g4305a, a4720g, c5421t, a5474c, c5655t, c5724t, t5770c, c5883t, c6179t, c6332t, c6507t, a6522g, t6555c, c6796a, c6831t, t6857c, g6898t, c6912t, t6955c, a7005g, t7017c, c7087t, t7131c, c7134t, g7140a, t7179c, t7203c, c7272t, c7293t, c7326t, c7356t, c7431t, c7652t, c7699t, g7791a, g7836a, a8203g, c8819t, t9003c, c9159t, t9420c, c9498t, t10236c, c10581t, t10596c, a10846g, a11280g, t11457c, c11602t, c11628t, c11727t, c12051t, c12180t, c12451t, c12969t, c13914t, c14672t, g16076a, t16505c, t17177g, c17189t, t17279c, t17438a, c17636t, g17747a, c17768t, t18116c, c18164t, c18443t, a18530g, c18596t, g18629a, c18677t, t18866c, g18874a, a18941g, t19070c, t19128c, g19163a, c19196t, t19223g, t19235c, c19439t, c19449t, c19532t, t19544c, a19578c, t19588c, t19616c, t19976a, t19698c, a19854g, t19868c, t20006c, c20072t, c20201t, t20226c, c20252t, a20495g, c20519t, a20540t, t20574c, c20612t, c20705t, a20741g, g20747a, a20762g, g20771a, t20783c, t20816c, t20921c, t21116c, c21167t, c21377t

ORF1ab: H165Y, A351V, V353A, L501S, S505A, K513R, M567T, T592I, N623S, E743D, H1030Y, N1138K, D1151E, K1155R, T1177K, M1188V, V1248I, A1274T, I1487V, N1738T, S1973F, A2024V, L2179I, I2199T, V2213F, T2464I, S2853F, I3529V, R6205Q, V6385A, I6474V

Häufigkeit der Mutationen

c --> t 68
t --> c 44
a --> g 20
g --> a 18
t --> g 7
g --> t 3
a --> t 3
t --> a 3
a --> c 3
c --> a 2
g --> c 1
c --> g 0


  • Es wird häufiger c in t verwandelt als t in c.
  • Es wird häufiger a in g verwandelt als g in a.
  • Das sind normale Alterserscheinungen die unter Mitwirkung von Methyltransferasen entstehen. Die Methylierung selbst ist noch keine Mutation sondern eine Modifikation.
  • In ORF1ab sind 172 Mutationen vorhanden.
  • Es gibt 150 Transitionen und 22 Transversionen.
  • Das Verhältnis Transitionen zu Transversionen beträgt im Polyprotein 1ab 6,82:1.


Ich fand zufällig zwei Viren die im Abstand von 7 Jahren gesammelt wurden und gleich 2 identische Gensequenzabschnitte aufweisen. Die Länge dieser komplett identischen Genabschnitte beträgt 748 und 647 Nukleotide. Nach 7 Jahren würde ich eigentlich nicht so auffällig lange komplett identische Sequenzen erwarten. Ich würde da eher sowas wie 99 bis 99,5% Ähnlichkeit erwarten. Ebenfalls identisch sind die letzten 339 Nukleotide. Den Poly-A-Schwanz habe ich nicht mitgezählt da dieser unterschiedliche Längen hat.

Ähnlichkeitsdiagramm F46 und RsYN03 Identische Genfragmente F46 und RsYN03

KU973692.1 UNVERIFIED: SARS-related coronavirus isolate F46, complete genome

  • Wirt: Fledermaus
  • Fundort: China
  • Zeitpunkt der Probenentnahme: 2012

MZ081379.1 Betacoronavirus sp. RsYN03 strain bat/Yunnan/RsYN03/2019, complete genome

  • Wirt: Rhinolophus sinicus
  • Fundort: 21.9189 N 101.2716 E
  • Zeitpunkt der Probenentnahme: 22-Oct-2019

Überraschenderweise habe ich zwei weitere identische Sequenzen in einem Virus von 2012 gefunden. Diese sind 461 und 401 Nukleotide lang.

Ähnlichkeitsdiagramm Rf4092 und RsYN03 Identische Genfragmente Rf4092 und RsYN03

KY417145.1 Bat SARS-like coronavirus isolate Rf4092, complete genome

  • Wirt: Rhinilophus ferrumequinum
  • Fundort: China
  • Zeitpunkt der Probenentnahme: 18-Sep-2012

RaTG13 und BANAL-20-52/Laos/2020

Ähnlichkeitsdiagramm RaTG13 und BANAL-20-52

Heute habe ich ein weiteres Rekombinationsereignis entdeckt. Diesmal handelt es sich um 2 nahe verwandte von Corona.

RaTG13 (26098..26510)
BANAL-20-52/Laos/2020 (26050..26462)

Dieser Bereich hat eine Länge von 413 Nukleotiden und umfasst vollständig das Envelope-Protein. Corona hat in diesem Bereich 2 Abweichungen. RacCS203 hat in diesem Abschnitt 7 Abweichungen.

Der Altersunterschied beträgt etwa 7 Jahre. Das Spike-Protein hat 28 nichtsynonyme Mutationen von denen sich 21 in der Rezeptorbindungsdomäne (RBD) befinden. Es sind keine Deletionen im Spike-Protein vorhanden. Um herauszufinden ob das viel ist habe ich die Spikeproteine von CoVZC45 (Feb. 2017) und HN2021A (Feb. 2021) verglichen. Da gibt es nach 4 Jahren nur 10 nichtsynonyme Mutationen. Davon befinden sich 3 in der RBD.


Die nachfolgenden Viren sind keine nahen verwandten von SARS oder Corona und wurden auch nicht in Fledermäusen gefunden, deshalb habe ich hier die Überschrift sonstige gewählt.

EU186072.1 (12.352..12.666) Feline coronavirus isolate Black / USA 1970er
MG893511.1 (12.361..12.675) Feline coronavirus isolate Felix / Deutschland 2012

In zwei Katzen auf zwei unterschiedlichen Kontinenten die sich im Abstand von etwa 40 Jahren infiziert haben fand ich 315 aufeinanderfolgende identische Nukleotide.


Ihr möchtet sicherlich alle wissen ob Corona ein Laborvirus ist. Das möchte ich auch wissen. Bisher konnte ich noch nicht zu eindeutigen Ergebnis kommen. Bisher fand ich heraus, dass das Mutationsverhalten von Viren nicht immer gleich ist und somit möglicherweise vom Wirt abhängig ist. In der Omikron-Variante fand ich 45 Punktmutationen in proteinogenen Bereichen, davon befanden sich 14 an Position 1 eines Codons, 18 an Position 2 und 13 am Ende des Codons. Es liegt also eine einigermaßen gleichmäßige Verteilung vor. In Fledermausviren hingegen befinden sich die meisten Punktmutationen am Ende eines Codons, das können mehr als 90% sein. Der Rest befindet sich dann überwiegend am Anfang während Mutationen in der Mitte eher Ausnahmen sind. An dieser Stelle möchte ich noch darauf hinweisen dass ich üblicherweise nicht das komplette Virus mit einem anderen vergleiche, da das sehr zeitaufwendig sein kann. Daher nehme ich eher Stichproben und vergleiche nur die Helicaseproteine, das kann man auf jeden Fall an einem Tag schaffen. Ich habe mich ganz bewusst für das Helicaseprotein entschieden, da ich das neuartige Coronavirus SARS-COV-2 als erstes mit SARS Tor2 verglichen habe. Um Zeit zu sparen habe ich erstmal nur die Proteine miteinander verglichen und fand ein Protein das nur eine einzige Mutation hatte und hielt Corona natürlich sofort für einen Hybrid. Als ich mir dann die Nukleotide anschaute fand ich mehr als 200 synonyme Mutationen. Ich dachte mir wenn es so schwer ist da eine Mutation rein zu bekommen muss es ja auch irgendwo ein komplett identisches Helicaseprotein geben. Die Suche dauerte eine Ewigkeit denn selbst nahe Verwandte hatten immer ein Protein das anders war. Es dauerte vermutlich über ein Jahr bis ich endlich in Laos identische Helicaseproteine fand.

Bei nah verwandten Viren und manchmal auch entfernt Verwandte in der selben Fledermausart z.B. RhGB01 und Khosta-2 ist das Verhältnis zwischen Transitionen und Transversionen auffällig hoch und liegt meistens bei etwa 7:1. Es manchen Vergleichen stellt man ein eher niedriges Verhältnis fest, diese waren dann vermutlich vorher in einem anderen Wirt oder sind schon so oft mutiert dass nicht mehr nachvollziehbar ist wie oft ein einzelnes Nukleotid ausgetauscht wurde. Wenn auf eine Transversion eine oder mehrere Transitionen folgen und immer das selbe Nukleotid betroffen ist sieht immer noch wie eine Transversion aus. Wenn nahe Verwandte ein niedriges Verhältnis zwischen Transitionen und Transversionen aufweisen deutet dies vermutlich eher darauf hin dass die Mutationen, oder zumindestens nicht alle, nicht von einer Fledermaus stammen.